Incidental Mutation 'R1192:Cdh22'
ID100860
Institutional Source Beutler Lab
Gene Symbol Cdh22
Ensembl Gene ENSMUSG00000053166
Gene Namecadherin 22
SynonymsPB-cadherin
MMRRC Submission 039264-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R1192 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location165111507-165234853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 165135283 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 439 (F439I)
Ref Sequence ENSEMBL: ENSMUSP00000066864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065438] [ENSMUST00000138643]
Predicted Effect probably damaging
Transcript: ENSMUST00000065438
AA Change: F439I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066864
Gene: ENSMUSG00000053166
AA Change: F439I

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
CA 82 163 2.19e-16 SMART
CA 187 272 3.11e-30 SMART
CA 296 390 4.88e-14 SMART
CA 413 494 2.27e-23 SMART
CA 517 604 4.52e-9 SMART
transmembrane domain 622 644 N/A INTRINSIC
Pfam:Cadherin_C 647 803 4.3e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138643
SMART Domains Protein: ENSMUSP00000120785
Gene: ENSMUSG00000053166

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
CA 82 163 2.19e-16 SMART
CA 187 272 3.11e-30 SMART
CA 296 390 4.88e-14 SMART
Meta Mutation Damage Score 0.414 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily. The gene product is composed of five cadherin repeat domains and a cytoplasmic tail similar to the highly conserved cytoplasmic region of classical cadherins. Expressed predominantly in the brain, this putative calcium-dependent cell adhesion protein may play an important role in morphogenesis and tissue formation in neural and non-neural cells during development and maintenance of the brain and neuroendocrine organs. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahrr T A 13: 74,214,403 M326L probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ankmy1 T C 1: 92,883,894 T591A probably damaging Het
Anks4b A T 7: 120,174,066 I50L probably benign Het
Arhgef3 C A 14: 27,379,706 T133N probably damaging Het
Arrdc1 T C 2: 24,926,140 I284V probably benign Het
Ccdc88a T A 11: 29,504,049 D717E possibly damaging Het
Creld1 G T 6: 113,489,479 C169F probably damaging Het
Ctsq T A 13: 61,039,045 N78I probably damaging Het
Eif4g3 T A 4: 138,171,186 H1089Q probably damaging Het
Eri2 G T 7: 119,792,317 D41E probably damaging Het
Exosc9 C T 3: 36,552,755 probably benign Het
Galnt14 C T 17: 73,545,138 probably benign Het
Gen1 C T 12: 11,255,218 G192D probably damaging Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ints14 T C 9: 64,966,763 V99A possibly damaging Het
Iqsec1 G A 6: 90,671,976 probably benign Het
Jarid2 G T 13: 44,906,545 R713L probably damaging Het
Nans T C 4: 46,502,430 probably benign Het
Nkiras2 T C 11: 100,625,980 probably null Het
Obscn A T 11: 59,067,199 D3558E probably benign Het
Olfr798 C T 10: 129,626,037 S8N probably benign Het
Palb2 G A 7: 122,128,209 T146M probably benign Het
Pcgf3 T C 5: 108,486,188 V104A probably benign Het
Polr3e A G 7: 120,933,308 D189G probably benign Het
Rfc1 T C 5: 65,293,911 K278R probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Shcbp1l T A 1: 153,425,507 I95N possibly damaging Het
Shox2 G A 3: 66,973,910 Q246* probably null Het
Slc16a4 G C 3: 107,298,873 E86D probably benign Het
Tubgcp2 A G 7: 140,029,838 V202A probably benign Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Other mutations in Cdh22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Cdh22 APN 2 165112601 missense possibly damaging 0.54
IGL01868:Cdh22 APN 2 165157358 missense probably damaging 0.99
IGL01932:Cdh22 APN 2 165170808 missense probably benign 0.05
IGL02268:Cdh22 APN 2 165123719 splice site probably benign
IGL02455:Cdh22 APN 2 165142255 missense possibly damaging 0.46
IGL03231:Cdh22 APN 2 165116206 missense probably benign 0.16
IGL03264:Cdh22 APN 2 165116173 missense probably benign 0.21
IGL03014:Cdh22 UTSW 2 165112411 nonsense probably null
R0712:Cdh22 UTSW 2 165170656 missense probably damaging 1.00
R0865:Cdh22 UTSW 2 165181056 missense probably damaging 0.98
R1700:Cdh22 UTSW 2 165170796 missense probably damaging 1.00
R1844:Cdh22 UTSW 2 165143694 missense probably damaging 1.00
R2005:Cdh22 UTSW 2 165180923 missense probably damaging 1.00
R2137:Cdh22 UTSW 2 165116394 splice site probably benign
R2270:Cdh22 UTSW 2 165143847 splice site probably null
R2271:Cdh22 UTSW 2 165143847 splice site probably null
R2272:Cdh22 UTSW 2 165143847 splice site probably null
R4021:Cdh22 UTSW 2 165143673 missense possibly damaging 0.81
R4022:Cdh22 UTSW 2 165157253 missense probably benign 0.14
R4613:Cdh22 UTSW 2 165143656 missense probably benign
R4625:Cdh22 UTSW 2 165112606 missense probably damaging 1.00
R5038:Cdh22 UTSW 2 165142277 missense probably benign 0.16
R5057:Cdh22 UTSW 2 165116143 missense probably damaging 0.98
R5649:Cdh22 UTSW 2 165116280 missense probably damaging 1.00
R6175:Cdh22 UTSW 2 165146630 missense probably damaging 0.98
R6297:Cdh22 UTSW 2 165143644 missense possibly damaging 0.86
R6445:Cdh22 UTSW 2 165170692 missense probably damaging 0.97
Z1088:Cdh22 UTSW 2 165112430 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCCCTGCCTATTCATCTGAGCAC -3'
(R):5'- AACTAAGACTCAGGATGCCTGCCC -3'

Sequencing Primer
(F):5'- TGAGCACCTCTCCCCTAATG -3'
(R):5'- cccctgcctctgccATC -3'
Posted On2014-01-15