Incidental Mutation 'R1192:Shox2'
ID100864
Institutional Source Beutler Lab
Gene Symbol Shox2
Ensembl Gene ENSMUSG00000027833
Gene Nameshort stature homeobox 2
SynonymsPrx3, 6330543G17Rik, Og12x
MMRRC Submission 039264-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.671) question?
Stock #R1192 (G1)
Quality Score209
Status Validated
Chromosome3
Chromosomal Location66971727-66981771 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 66973910 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 246 (Q246*)
Ref Sequence ENSEMBL: ENSMUSP00000029422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029422] [ENSMUST00000162060] [ENSMUST00000162439] [ENSMUST00000195261]
Predicted Effect probably null
Transcript: ENSMUST00000029422
AA Change: Q246*
SMART Domains Protein: ENSMUSP00000029422
Gene: ENSMUSG00000027833
AA Change: Q246*

DomainStartEndE-ValueType
low complexity region 57 90 N/A INTRINSIC
HOX 140 202 1.8e-28 SMART
low complexity region 258 273 N/A INTRINSIC
Pfam:OAR 310 327 3.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162060
SMART Domains Protein: ENSMUSP00000125031
Gene: ENSMUSG00000027833

DomainStartEndE-ValueType
HOX 11 73 1.8e-28 SMART
low complexity region 117 132 N/A INTRINSIC
Pfam:OAR 167 187 9.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162098
SMART Domains Protein: ENSMUSP00000123838
Gene: ENSMUSG00000027833

DomainStartEndE-ValueType
low complexity region 1 11 N/A INTRINSIC
HOX 61 123 1.8e-28 SMART
low complexity region 167 182 N/A INTRINSIC
Pfam:OAR 219 236 1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162439
SMART Domains Protein: ENSMUSP00000124924
Gene: ENSMUSG00000027833

DomainStartEndE-ValueType
HOX 11 73 1.8e-28 SMART
low complexity region 117 132 N/A INTRINSIC
Pfam:OAR 167 187 9.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195261
SMART Domains Protein: ENSMUSP00000141625
Gene: ENSMUSG00000027833

DomainStartEndE-ValueType
HOX 11 73 9e-31 SMART
Meta Mutation Damage Score 0.612 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the homeobox family of genes that encode proteins containing a 60-amino acid residue motif that represents a DNA binding domain. Homeobox genes have been characterized extensively as transcriptional regulators involved in pattern formation in both invertebrate and vertebrate species. Several human genetic disorders are caused by aberrations in human homeobox genes. This locus represents a pseudoautosomal homeobox gene that is thought to be responsible for idiopathic short stature, and it is implicated in the short stature phenotype of Turner syndrome patients. This gene is considered to be a candidate gene for Cornelia de Lange syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]
PHENOTYPE: Homozygous null mice display incomplete penetrance of embryonic lethality during organogenesis and incomplete clefting of the anterior part of the palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahrr T A 13: 74,214,403 M326L probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ankmy1 T C 1: 92,883,894 T591A probably damaging Het
Anks4b A T 7: 120,174,066 I50L probably benign Het
Arhgef3 C A 14: 27,379,706 T133N probably damaging Het
Arrdc1 T C 2: 24,926,140 I284V probably benign Het
Ccdc88a T A 11: 29,504,049 D717E possibly damaging Het
Cdh22 A T 2: 165,135,283 F439I probably damaging Het
Creld1 G T 6: 113,489,479 C169F probably damaging Het
Ctsq T A 13: 61,039,045 N78I probably damaging Het
Eif4g3 T A 4: 138,171,186 H1089Q probably damaging Het
Eri2 G T 7: 119,792,317 D41E probably damaging Het
Exosc9 C T 3: 36,552,755 probably benign Het
Galnt14 C T 17: 73,545,138 probably benign Het
Gen1 C T 12: 11,255,218 G192D probably damaging Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ints14 T C 9: 64,966,763 V99A possibly damaging Het
Iqsec1 G A 6: 90,671,976 probably benign Het
Jarid2 G T 13: 44,906,545 R713L probably damaging Het
Nans T C 4: 46,502,430 probably benign Het
Nkiras2 T C 11: 100,625,980 probably null Het
Obscn A T 11: 59,067,199 D3558E probably benign Het
Olfr798 C T 10: 129,626,037 S8N probably benign Het
Palb2 G A 7: 122,128,209 T146M probably benign Het
Pcgf3 T C 5: 108,486,188 V104A probably benign Het
Polr3e A G 7: 120,933,308 D189G probably benign Het
Rfc1 T C 5: 65,293,911 K278R probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Shcbp1l T A 1: 153,425,507 I95N possibly damaging Het
Slc16a4 G C 3: 107,298,873 E86D probably benign Het
Tubgcp2 A G 7: 140,029,838 V202A probably benign Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Other mutations in Shox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Shox2 APN 3 66981441 missense possibly damaging 0.49
IGL00813:Shox2 APN 3 66975444 missense probably damaging 1.00
IGL01534:Shox2 APN 3 66978363 missense probably benign 0.01
IGL01583:Shox2 APN 3 66973771 unclassified probably benign
R0306:Shox2 UTSW 3 66973834 missense probably damaging 0.98
R0374:Shox2 UTSW 3 66973851 missense probably damaging 0.98
R0625:Shox2 UTSW 3 66981544 critical splice donor site probably null
R0774:Shox2 UTSW 3 66973811 missense probably damaging 1.00
R1102:Shox2 UTSW 3 66978295 missense probably damaging 1.00
R2354:Shox2 UTSW 3 66981489 missense possibly damaging 0.94
R2518:Shox2 UTSW 3 66978359 missense possibly damaging 0.83
R4163:Shox2 UTSW 3 66973771 unclassified probably benign
R4976:Shox2 UTSW 3 66973675 unclassified probably benign
R5423:Shox2 UTSW 3 66973754 unclassified probably benign
R5493:Shox2 UTSW 3 66981463 missense probably damaging 1.00
R6528:Shox2 UTSW 3 66981285 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCCGCGATGCTGGAGTTCTTG -3'
(R):5'- TCACGTATTCACCCACGCAGTC -3'

Sequencing Primer
(F):5'- GGAGTTCTTGCTGGTGGTC -3'
(R):5'- GAAGGGACCACCTCATTCTTG -3'
Posted On2014-01-15