Incidental Mutation 'R1192:Slc16a4'
ID100866
Institutional Source Beutler Lab
Gene Symbol Slc16a4
Ensembl Gene ENSMUSG00000027896
Gene Namesolute carrier family 16 (monocarboxylic acid transporters), member 4
Synonyms
MMRRC Submission 039264-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.259) question?
Stock #R1192 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location107291230-107312115 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 107298873 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 86 (E86D)
Ref Sequence ENSEMBL: ENSMUSP00000102334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029502] [ENSMUST00000106723]
Predicted Effect probably benign
Transcript: ENSMUST00000029502
AA Change: E86D

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000029502
Gene: ENSMUSG00000027896
AA Change: E86D

DomainStartEndE-ValueType
Pfam:MFS_1 27 373 8.2e-26 PFAM
Pfam:MFS_1 305 499 2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106723
AA Change: E86D

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000102334
Gene: ENSMUSG00000027896
AA Change: E86D

DomainStartEndE-ValueType
Pfam:MFS_1 27 375 2.1e-28 PFAM
Pfam:MFS_1 327 462 3.6e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153322
Meta Mutation Damage Score 0.166 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency 97% (32/33)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahrr T A 13: 74,214,403 M326L probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ankmy1 T C 1: 92,883,894 T591A probably damaging Het
Anks4b A T 7: 120,174,066 I50L probably benign Het
Arhgef3 C A 14: 27,379,706 T133N probably damaging Het
Arrdc1 T C 2: 24,926,140 I284V probably benign Het
Ccdc88a T A 11: 29,504,049 D717E possibly damaging Het
Cdh22 A T 2: 165,135,283 F439I probably damaging Het
Creld1 G T 6: 113,489,479 C169F probably damaging Het
Ctsq T A 13: 61,039,045 N78I probably damaging Het
Eif4g3 T A 4: 138,171,186 H1089Q probably damaging Het
Eri2 G T 7: 119,792,317 D41E probably damaging Het
Exosc9 C T 3: 36,552,755 probably benign Het
Galnt14 C T 17: 73,545,138 probably benign Het
Gen1 C T 12: 11,255,218 G192D probably damaging Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ints14 T C 9: 64,966,763 V99A possibly damaging Het
Iqsec1 G A 6: 90,671,976 probably benign Het
Jarid2 G T 13: 44,906,545 R713L probably damaging Het
Nans T C 4: 46,502,430 probably benign Het
Nkiras2 T C 11: 100,625,980 probably null Het
Obscn A T 11: 59,067,199 D3558E probably benign Het
Olfr798 C T 10: 129,626,037 S8N probably benign Het
Palb2 G A 7: 122,128,209 T146M probably benign Het
Pcgf3 T C 5: 108,486,188 V104A probably benign Het
Polr3e A G 7: 120,933,308 D189G probably benign Het
Rfc1 T C 5: 65,293,911 K278R probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Shcbp1l T A 1: 153,425,507 I95N possibly damaging Het
Shox2 G A 3: 66,973,910 Q246* probably null Het
Tubgcp2 A G 7: 140,029,838 V202A probably benign Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Other mutations in Slc16a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Slc16a4 APN 3 107303100 missense possibly damaging 0.67
IGL01311:Slc16a4 APN 3 107292505 missense possibly damaging 0.83
IGL01509:Slc16a4 APN 3 107311434 critical splice acceptor site probably null
IGL01780:Slc16a4 APN 3 107303099 missense probably benign 0.00
IGL02294:Slc16a4 APN 3 107301068 missense probably benign 0.00
IGL02350:Slc16a4 APN 3 107303099 missense probably benign 0.00
IGL02357:Slc16a4 APN 3 107303099 missense probably benign 0.00
IGL02792:Slc16a4 APN 3 107298877 missense probably benign
IGL02873:Slc16a4 APN 3 107300795 missense probably benign 0.00
IGL03001:Slc16a4 APN 3 107311542 missense possibly damaging 0.91
IGL03002:Slc16a4 APN 3 107300786 missense probably benign 0.07
R0370:Slc16a4 UTSW 3 107301097 missense possibly damaging 0.66
R0525:Slc16a4 UTSW 3 107297939 splice site probably benign
R1458:Slc16a4 UTSW 3 107300932 missense probably benign 0.00
R1939:Slc16a4 UTSW 3 107301001 missense probably benign 0.00
R2061:Slc16a4 UTSW 3 107300711 missense probably benign 0.00
R2098:Slc16a4 UTSW 3 107300847 nonsense probably null
R2102:Slc16a4 UTSW 3 107304503 splice site probably null
R3411:Slc16a4 UTSW 3 107300872 missense probably benign
R4983:Slc16a4 UTSW 3 107300860 missense probably benign 0.00
R5394:Slc16a4 UTSW 3 107292442 missense probably benign
R5804:Slc16a4 UTSW 3 107298964 missense probably benign 0.04
R6077:Slc16a4 UTSW 3 107301065 missense possibly damaging 0.91
R6626:Slc16a4 UTSW 3 107301196 missense possibly damaging 0.95
R6693:Slc16a4 UTSW 3 107303064 missense probably damaging 1.00
R6811:Slc16a4 UTSW 3 107298917 missense probably benign 0.06
R6823:Slc16a4 UTSW 3 107311498 missense probably benign 0.02
R6982:Slc16a4 UTSW 3 107299273 missense probably benign 0.01
X0018:Slc16a4 UTSW 3 107300815 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCTGCAAGTGAAACCATTCAGCTC -3'
(R):5'- AATGTCAGCCCCATTCCAGAACGG -3'

Sequencing Primer
(F):5'- GTGAAACCATTCAGCTCTAACTATG -3'
(R):5'- TGAGTGTGAACTCACCAGGT -3'
Posted On2014-01-15