Incidental Mutation 'R1192:Nans'
ID100868
Institutional Source Beutler Lab
Gene Symbol Nans
Ensembl Gene ENSMUSG00000028334
Gene NameN-acetylneuraminic acid synthase (sialic acid synthase)
Synonyms4632418E04Rik, N-acetylneuraminic acid phosphate synthase, Sas
MMRRC Submission 039264-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.748) question?
Stock #R1192 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location46489248-46503632 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 46502430 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030018] [ENSMUST00000046897] [ENSMUST00000184112]
Predicted Effect probably benign
Transcript: ENSMUST00000030018
SMART Domains Protein: ENSMUSP00000030018
Gene: ENSMUSG00000028334

DomainStartEndE-ValueType
Pfam:NeuB 39 278 4.7e-81 PFAM
SAF 292 351 2.38e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000046897
SMART Domains Protein: ENSMUSP00000038719
Gene: ENSMUSG00000039853

DomainStartEndE-ValueType
BBOX 17 59 1.84e-8 SMART
low complexity region 115 126 N/A INTRINSIC
PRY 264 316 2.63e-13 SMART
SPRY 317 440 2.48e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150584
Predicted Effect probably benign
Transcript: ENSMUST00000184112
SMART Domains Protein: ENSMUSP00000138876
Gene: ENSMUSG00000039853

DomainStartEndE-ValueType
BBOX 17 59 1.84e-8 SMART
low complexity region 115 126 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that functions in the biosynthetic pathways of sialic acids. In vitro, the encoded protein uses N-acetylmannosamine 6-phosphate and mannose 6-phosphate as substrates to generate phosphorylated forms of N-acetylneuraminic acid (Neu5Ac) and 2-keto-3-deoxy-D-glycero-D-galacto-nononic acid (KDN), respectively; however, it exhibits much higher activity toward the Neu5Ac phosphate product. In insect cells, expression of this gene results in Neu5Ac and KDN production. This gene is related to the E. coli sialic acid synthase gene neuB, and it can partially restore sialic acid synthase activity in an E. coli neuB-negative mutant. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahrr T A 13: 74,214,403 M326L probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ankmy1 T C 1: 92,883,894 T591A probably damaging Het
Anks4b A T 7: 120,174,066 I50L probably benign Het
Arhgef3 C A 14: 27,379,706 T133N probably damaging Het
Arrdc1 T C 2: 24,926,140 I284V probably benign Het
Ccdc88a T A 11: 29,504,049 D717E possibly damaging Het
Cdh22 A T 2: 165,135,283 F439I probably damaging Het
Creld1 G T 6: 113,489,479 C169F probably damaging Het
Ctsq T A 13: 61,039,045 N78I probably damaging Het
Eif4g3 T A 4: 138,171,186 H1089Q probably damaging Het
Eri2 G T 7: 119,792,317 D41E probably damaging Het
Exosc9 C T 3: 36,552,755 probably benign Het
Galnt14 C T 17: 73,545,138 probably benign Het
Gen1 C T 12: 11,255,218 G192D probably damaging Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ints14 T C 9: 64,966,763 V99A possibly damaging Het
Iqsec1 G A 6: 90,671,976 probably benign Het
Jarid2 G T 13: 44,906,545 R713L probably damaging Het
Nkiras2 T C 11: 100,625,980 probably null Het
Obscn A T 11: 59,067,199 D3558E probably benign Het
Olfr798 C T 10: 129,626,037 S8N probably benign Het
Palb2 G A 7: 122,128,209 T146M probably benign Het
Pcgf3 T C 5: 108,486,188 V104A probably benign Het
Polr3e A G 7: 120,933,308 D189G probably benign Het
Rfc1 T C 5: 65,293,911 K278R probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Shcbp1l T A 1: 153,425,507 I95N possibly damaging Het
Shox2 G A 3: 66,973,910 Q246* probably null Het
Slc16a4 G C 3: 107,298,873 E86D probably benign Het
Tubgcp2 A G 7: 140,029,838 V202A probably benign Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Other mutations in Nans
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1016:Nans UTSW 4 46500716 missense probably benign 0.23
R1493:Nans UTSW 4 46500761 missense probably damaging 1.00
R1912:Nans UTSW 4 46500162 missense probably damaging 1.00
R3799:Nans UTSW 4 46492839 missense probably benign 0.05
R4980:Nans UTSW 4 46492764 missense probably benign 0.03
R5212:Nans UTSW 4 46502547 missense possibly damaging 0.56
R5723:Nans UTSW 4 46499083 missense probably benign 0.08
R5854:Nans UTSW 4 46500180 missense probably damaging 1.00
R5990:Nans UTSW 4 46489441 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCCAGCACCTTTTAACAGGGAAAC -3'
(R):5'- CGGATTCTTCCATGACCGTGTCATC -3'

Sequencing Primer
(F):5'- CCAATATGCTGGCTTACTGGAAAG -3'
(R):5'- GTCATCTTCTTCGATAGTGACCAG -3'
Posted On2014-01-15