Incidental Mutation 'R1192:Iqsec1'
ID100878
Institutional Source Beutler Lab
Gene Symbol Iqsec1
Ensembl Gene ENSMUSG00000034312
Gene NameIQ motif and Sec7 domain 1
SynonymsD6Ertd349e, cI-43, BRAG2
MMRRC Submission 039264-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.357) question?
Stock #R1192 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location90656088-90988685 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 90671976 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101151] [ENSMUST00000101153] [ENSMUST00000212100]
Predicted Effect probably benign
Transcript: ENSMUST00000101151
SMART Domains Protein: ENSMUSP00000098710
Gene: ENSMUSG00000034312

DomainStartEndE-ValueType
low complexity region 57 68 N/A INTRINSIC
Blast:Sec7 69 369 6e-39 BLAST
low complexity region 370 389 N/A INTRINSIC
low complexity region 396 430 N/A INTRINSIC
low complexity region 450 481 N/A INTRINSIC
Sec7 505 696 1.31e-95 SMART
PH 737 848 2.39e-2 SMART
low complexity region 901 914 N/A INTRINSIC
low complexity region 963 976 N/A INTRINSIC
low complexity region 978 1000 N/A INTRINSIC
low complexity region 1014 1060 N/A INTRINSIC
low complexity region 1062 1094 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101153
SMART Domains Protein: ENSMUSP00000098712
Gene: ENSMUSG00000034312

DomainStartEndE-ValueType
low complexity region 71 82 N/A INTRINSIC
Blast:Sec7 83 383 4e-39 BLAST
low complexity region 384 403 N/A INTRINSIC
low complexity region 410 444 N/A INTRINSIC
low complexity region 464 495 N/A INTRINSIC
Sec7 519 710 1.31e-95 SMART
PH 751 862 2.39e-2 SMART
low complexity region 915 928 N/A INTRINSIC
low complexity region 948 957 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154198
Predicted Effect probably benign
Transcript: ENSMUST00000212100
Meta Mutation Damage Score 0.0672 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency 97% (32/33)
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele activated in neurons fail to exhibit mGluR- and NMDAR-mediated long term depression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahrr T A 13: 74,214,403 M326L probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ankmy1 T C 1: 92,883,894 T591A probably damaging Het
Anks4b A T 7: 120,174,066 I50L probably benign Het
Arhgef3 C A 14: 27,379,706 T133N probably damaging Het
Arrdc1 T C 2: 24,926,140 I284V probably benign Het
Ccdc88a T A 11: 29,504,049 D717E possibly damaging Het
Cdh22 A T 2: 165,135,283 F439I probably damaging Het
Creld1 G T 6: 113,489,479 C169F probably damaging Het
Ctsq T A 13: 61,039,045 N78I probably damaging Het
Eif4g3 T A 4: 138,171,186 H1089Q probably damaging Het
Eri2 G T 7: 119,792,317 D41E probably damaging Het
Exosc9 C T 3: 36,552,755 probably benign Het
Galnt14 C T 17: 73,545,138 probably benign Het
Gen1 C T 12: 11,255,218 G192D probably damaging Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ints14 T C 9: 64,966,763 V99A possibly damaging Het
Jarid2 G T 13: 44,906,545 R713L probably damaging Het
Nans T C 4: 46,502,430 probably benign Het
Nkiras2 T C 11: 100,625,980 probably null Het
Obscn A T 11: 59,067,199 D3558E probably benign Het
Olfr798 C T 10: 129,626,037 S8N probably benign Het
Palb2 G A 7: 122,128,209 T146M probably benign Het
Pcgf3 T C 5: 108,486,188 V104A probably benign Het
Polr3e A G 7: 120,933,308 D189G probably benign Het
Rfc1 T C 5: 65,293,911 K278R probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Shcbp1l T A 1: 153,425,507 I95N possibly damaging Het
Shox2 G A 3: 66,973,910 Q246* probably null Het
Slc16a4 G C 3: 107,298,873 E86D probably benign Het
Tubgcp2 A G 7: 140,029,838 V202A probably benign Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Other mutations in Iqsec1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Iqsec1 APN 6 90689703 missense probably damaging 1.00
IGL01749:Iqsec1 APN 6 90680504 missense probably benign 0.03
IGL01960:Iqsec1 APN 6 90676780 missense probably damaging 1.00
IGL02007:Iqsec1 APN 6 90690349 missense probably benign 0.37
IGL02045:Iqsec1 APN 6 90664069 missense probably damaging 0.96
IGL02186:Iqsec1 APN 6 90676877 missense probably damaging 1.00
IGL02211:Iqsec1 APN 6 90671609 missense probably damaging 1.00
IGL02503:Iqsec1 APN 6 90668788 missense probably damaging 1.00
IGL02506:Iqsec1 APN 6 90672075 missense possibly damaging 0.94
IGL02554:Iqsec1 APN 6 90669345 missense probably damaging 1.00
R0139:Iqsec1 UTSW 6 90809758 intron probably benign
R0371:Iqsec1 UTSW 6 90670403 splice site probably benign
R0617:Iqsec1 UTSW 6 90689970 missense probably damaging 1.00
R0619:Iqsec1 UTSW 6 90670406 splice site probably null
R1157:Iqsec1 UTSW 6 90669384 missense possibly damaging 0.83
R1168:Iqsec1 UTSW 6 90689676 missense probably damaging 1.00
R1190:Iqsec1 UTSW 6 90689677 missense probably damaging 1.00
R1435:Iqsec1 UTSW 6 90672024 missense probably damaging 1.00
R1449:Iqsec1 UTSW 6 90690808 nonsense probably null
R1697:Iqsec1 UTSW 6 90809770 nonsense probably null
R1921:Iqsec1 UTSW 6 90662895 missense probably benign 0.00
R1958:Iqsec1 UTSW 6 90670459 missense probably damaging 1.00
R2017:Iqsec1 UTSW 6 90689930 missense probably benign 0.02
R2082:Iqsec1 UTSW 6 90694574 missense probably damaging 1.00
R2372:Iqsec1 UTSW 6 90694654 missense probably damaging 1.00
R2442:Iqsec1 UTSW 6 90689883 missense possibly damaging 0.52
R4120:Iqsec1 UTSW 6 90662602 nonsense probably null
R4371:Iqsec1 UTSW 6 90694606 missense probably damaging 1.00
R4645:Iqsec1 UTSW 6 90668013 missense probably damaging 1.00
R4864:Iqsec1 UTSW 6 90664056 missense probably damaging 1.00
R5436:Iqsec1 UTSW 6 90845361 intron probably benign
R5790:Iqsec1 UTSW 6 90689880 nonsense probably null
R6007:Iqsec1 UTSW 6 90660987 nonsense probably null
R6143:Iqsec1 UTSW 6 90809684 intron probably null
R6218:Iqsec1 UTSW 6 90689635 missense probably damaging 1.00
R6972:Iqsec1 UTSW 6 90676768 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTGATGTTCCCAAAGGTGGCTC -3'
(R):5'- ATCACTGTCCCTTGACCAGGTGTG -3'

Sequencing Primer
(F):5'- CTTGGAGGATCTAAGGGCATC -3'
(R):5'- CCTTGACCAGGTGTGGATGAC -3'
Posted On2014-01-15