Incidental Mutation 'R1192:Creld1'
ID100880
Institutional Source Beutler Lab
Gene Symbol Creld1
Ensembl Gene ENSMUSG00000030284
Gene Namecysteine-rich with EGF-like domains 1
SynonymsAI843811
MMRRC Submission 039264-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1192 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location113483297-113493343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 113489479 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 169 (C169F)
Ref Sequence ENSEMBL: ENSMUSP00000032422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032422] [ENSMUST00000101059] [ENSMUST00000204134] [ENSMUST00000204268]
Predicted Effect probably damaging
Transcript: ENSMUST00000032422
AA Change: C169F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032422
Gene: ENSMUSG00000030284
AA Change: C169F

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:DUF3456 45 103 1.7e-9 PFAM
EGF 154 193 2.11e1 SMART
FU 208 255 1.66e-1 SMART
EGF 213 244 2.2e1 SMART
EGF_like 245 290 4.26e-3 SMART
FU 268 315 4.46e-2 SMART
EGF_CA 305 344 1.1e-7 SMART
transmembrane domain 363 382 N/A INTRINSIC
transmembrane domain 387 406 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101059
SMART Domains Protein: ENSMUSP00000098620
Gene: ENSMUSG00000045009

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 125 136 N/A INTRINSIC
low complexity region 142 162 N/A INTRINSIC
low complexity region 239 252 N/A INTRINSIC
low complexity region 270 281 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
low complexity region 423 447 N/A INTRINSIC
transmembrane domain 463 485 N/A INTRINSIC
transmembrane domain 492 511 N/A INTRINSIC
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 561 583 N/A INTRINSIC
transmembrane domain 588 610 N/A INTRINSIC
transmembrane domain 630 652 N/A INTRINSIC
transmembrane domain 667 689 N/A INTRINSIC
low complexity region 885 905 N/A INTRINSIC
low complexity region 927 943 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135852
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156764
Predicted Effect probably benign
Transcript: ENSMUST00000204134
SMART Domains Protein: ENSMUSP00000145031
Gene: ENSMUSG00000045009

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 125 136 N/A INTRINSIC
low complexity region 142 162 N/A INTRINSIC
low complexity region 239 252 N/A INTRINSIC
low complexity region 270 281 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
low complexity region 424 448 N/A INTRINSIC
transmembrane domain 464 486 N/A INTRINSIC
transmembrane domain 493 512 N/A INTRINSIC
transmembrane domain 527 549 N/A INTRINSIC
transmembrane domain 562 584 N/A INTRINSIC
transmembrane domain 589 611 N/A INTRINSIC
transmembrane domain 631 653 N/A INTRINSIC
transmembrane domain 668 690 N/A INTRINSIC
low complexity region 886 906 N/A INTRINSIC
low complexity region 928 944 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204268
SMART Domains Protein: ENSMUSP00000145443
Gene: ENSMUSG00000045009

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 125 136 N/A INTRINSIC
low complexity region 142 162 N/A INTRINSIC
low complexity region 239 252 N/A INTRINSIC
low complexity region 270 281 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
low complexity region 424 448 N/A INTRINSIC
transmembrane domain 464 486 N/A INTRINSIC
transmembrane domain 493 512 N/A INTRINSIC
transmembrane domain 527 549 N/A INTRINSIC
transmembrane domain 562 584 N/A INTRINSIC
transmembrane domain 589 611 N/A INTRINSIC
transmembrane domain 631 653 N/A INTRINSIC
transmembrane domain 668 690 N/A INTRINSIC
low complexity region 886 906 N/A INTRINSIC
low complexity region 928 944 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204920
Meta Mutation Damage Score 0.56 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of epidermal growth factor-related proteins. The encoded protein is characterized by a cysteine-rich with epidermal growth factor-like domain. This protein may function as a cell adhesion molecule. Mutations in this gene are the cause of atrioventricular septal defect. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygous KO is embryonic lethal: abnormal vasculature and brain and craniofacial development and reduced atrioventricular cushion size at E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahrr T A 13: 74,214,403 M326L probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ankmy1 T C 1: 92,883,894 T591A probably damaging Het
Anks4b A T 7: 120,174,066 I50L probably benign Het
Arhgef3 C A 14: 27,379,706 T133N probably damaging Het
Arrdc1 T C 2: 24,926,140 I284V probably benign Het
Ccdc88a T A 11: 29,504,049 D717E possibly damaging Het
Cdh22 A T 2: 165,135,283 F439I probably damaging Het
Ctsq T A 13: 61,039,045 N78I probably damaging Het
Eif4g3 T A 4: 138,171,186 H1089Q probably damaging Het
Eri2 G T 7: 119,792,317 D41E probably damaging Het
Exosc9 C T 3: 36,552,755 probably benign Het
Galnt14 C T 17: 73,545,138 probably benign Het
Gen1 C T 12: 11,255,218 G192D probably damaging Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ints14 T C 9: 64,966,763 V99A possibly damaging Het
Iqsec1 G A 6: 90,671,976 probably benign Het
Jarid2 G T 13: 44,906,545 R713L probably damaging Het
Nans T C 4: 46,502,430 probably benign Het
Nkiras2 T C 11: 100,625,980 probably null Het
Obscn A T 11: 59,067,199 D3558E probably benign Het
Olfr798 C T 10: 129,626,037 S8N probably benign Het
Palb2 G A 7: 122,128,209 T146M probably benign Het
Pcgf3 T C 5: 108,486,188 V104A probably benign Het
Polr3e A G 7: 120,933,308 D189G probably benign Het
Rfc1 T C 5: 65,293,911 K278R probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Shcbp1l T A 1: 153,425,507 I95N possibly damaging Het
Shox2 G A 3: 66,973,910 Q246* probably null Het
Slc16a4 G C 3: 107,298,873 E86D probably benign Het
Tubgcp2 A G 7: 140,029,838 V202A probably benign Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Other mutations in Creld1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01924:Creld1 APN 6 113483960 missense probably benign
IGL01959:Creld1 APN 6 113492833 missense probably damaging 0.99
IGL03061:Creld1 APN 6 113488097 missense probably damaging 1.00
IGL03266:Creld1 APN 6 113489597 missense probably benign 0.05
impregnable UTSW 6 113489479 missense probably damaging 1.00
R1118:Creld1 UTSW 6 113491695 missense probably benign 0.01
R1144:Creld1 UTSW 6 113483961 missense probably benign 0.37
R1517:Creld1 UTSW 6 113489784 missense probably damaging 1.00
R1724:Creld1 UTSW 6 113484574 missense possibly damaging 0.81
R1882:Creld1 UTSW 6 113492205 missense probably damaging 1.00
R2411:Creld1 UTSW 6 113489776 missense probably benign 0.09
R3956:Creld1 UTSW 6 113492229 missense possibly damaging 0.68
R4757:Creld1 UTSW 6 113492247 missense probably benign 0.08
R4939:Creld1 UTSW 6 113488179 missense probably benign 0.13
R5887:Creld1 UTSW 6 113492899 makesense probably null
R6813:Creld1 UTSW 6 113489569 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTAGCCTGCATTAGAGCTATTGCTCC -3'
(R):5'- AGCTTCTGGCTACCTACCCGAACATAC -3'

Sequencing Primer
(F):5'- ggaggctgaggctagagg -3'
(R):5'- ACATACCAGATGGCTGCTG -3'
Posted On2014-01-15