Incidental Mutation 'R1192:Polr3e'
ID100886
Institutional Source Beutler Lab
Gene Symbol Polr3e
Ensembl Gene ENSMUSG00000030880
Gene Namepolymerase (RNA) III (DNA directed) polypeptide E
SynonymsSin, RPC5
MMRRC Submission 039264-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.927) question?
Stock #R1192 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location120917744-120947432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120933308 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 189 (D189G)
Ref Sequence ENSEMBL: ENSMUSP00000146970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033173] [ENSMUST00000106483] [ENSMUST00000207481]
Predicted Effect probably benign
Transcript: ENSMUST00000033173
AA Change: D215G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000033173
Gene: ENSMUSG00000030880
AA Change: D215G

DomainStartEndE-ValueType
Pfam:Sin_N 5 432 7.1e-161 PFAM
coiled coil region 458 491 N/A INTRINSIC
low complexity region 504 518 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106483
AA Change: D215G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000102092
Gene: ENSMUSG00000030880
AA Change: D215G

DomainStartEndE-ValueType
Pfam:Sin_N 4 29 2.8e-10 PFAM
Pfam:Sin_N 29 408 6.9e-141 PFAM
coiled coil region 432 465 N/A INTRINSIC
low complexity region 478 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207481
AA Change: D189G

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209014
Meta Mutation Damage Score 0.158 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency 97% (32/33)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahrr T A 13: 74,214,403 M326L probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ankmy1 T C 1: 92,883,894 T591A probably damaging Het
Anks4b A T 7: 120,174,066 I50L probably benign Het
Arhgef3 C A 14: 27,379,706 T133N probably damaging Het
Arrdc1 T C 2: 24,926,140 I284V probably benign Het
Ccdc88a T A 11: 29,504,049 D717E possibly damaging Het
Cdh22 A T 2: 165,135,283 F439I probably damaging Het
Creld1 G T 6: 113,489,479 C169F probably damaging Het
Ctsq T A 13: 61,039,045 N78I probably damaging Het
Eif4g3 T A 4: 138,171,186 H1089Q probably damaging Het
Eri2 G T 7: 119,792,317 D41E probably damaging Het
Exosc9 C T 3: 36,552,755 probably benign Het
Galnt14 C T 17: 73,545,138 probably benign Het
Gen1 C T 12: 11,255,218 G192D probably damaging Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ints14 T C 9: 64,966,763 V99A possibly damaging Het
Iqsec1 G A 6: 90,671,976 probably benign Het
Jarid2 G T 13: 44,906,545 R713L probably damaging Het
Nans T C 4: 46,502,430 probably benign Het
Nkiras2 T C 11: 100,625,980 probably null Het
Obscn A T 11: 59,067,199 D3558E probably benign Het
Olfr798 C T 10: 129,626,037 S8N probably benign Het
Palb2 G A 7: 122,128,209 T146M probably benign Het
Pcgf3 T C 5: 108,486,188 V104A probably benign Het
Rfc1 T C 5: 65,293,911 K278R probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Shcbp1l T A 1: 153,425,507 I95N possibly damaging Het
Shox2 G A 3: 66,973,910 Q246* probably null Het
Slc16a4 G C 3: 107,298,873 E86D probably benign Het
Tubgcp2 A G 7: 140,029,838 V202A probably benign Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Other mutations in Polr3e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Polr3e APN 7 120940811 nonsense probably null
IGL01664:Polr3e APN 7 120931317 splice site probably benign
IGL01980:Polr3e APN 7 120940296 splice site probably benign
IGL02027:Polr3e APN 7 120930963 missense probably damaging 1.00
IGL02208:Polr3e APN 7 120932140 missense probably damaging 0.99
IGL02549:Polr3e APN 7 120939759 missense probably damaging 1.00
IGL03338:Polr3e APN 7 120937620 missense probably benign 0.06
R1328:Polr3e UTSW 7 120933823 splice site probably benign
R1435:Polr3e UTSW 7 120940788 missense probably benign 0.16
R1528:Polr3e UTSW 7 120940597 missense probably damaging 1.00
R1754:Polr3e UTSW 7 120939298 critical splice donor site probably null
R1924:Polr3e UTSW 7 120940597 missense probably damaging 1.00
R2169:Polr3e UTSW 7 120932137 missense probably damaging 1.00
R2201:Polr3e UTSW 7 120932242 missense probably benign
R2362:Polr3e UTSW 7 120942564 missense probably damaging 1.00
R2696:Polr3e UTSW 7 120933377 missense probably damaging 1.00
R4416:Polr3e UTSW 7 120939057 critical splice donor site probably null
R5278:Polr3e UTSW 7 120922961 missense possibly damaging 0.67
R5560:Polr3e UTSW 7 120922949 missense possibly damaging 0.83
R5689:Polr3e UTSW 7 120940689 missense possibly damaging 0.82
R5790:Polr3e UTSW 7 120927967 missense probably damaging 1.00
R6242:Polr3e UTSW 7 120940467 missense possibly damaging 0.62
R6317:Polr3e UTSW 7 120927982 missense possibly damaging 0.49
R6334:Polr3e UTSW 7 120927999 missense possibly damaging 0.87
R6891:Polr3e UTSW 7 120944650 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGGTTTCTGCACTGTAGATGGAATACG -3'
(R):5'- TAGTAGCTCCTGGACAAGCCTCAC -3'

Sequencing Primer
(F):5'- CACTGTAGATGGAATACGAGGGC -3'
(R):5'- CATGAGGCTCATCTATGCCAG -3'
Posted On2014-01-15