Incidental Mutation 'R1192:Palb2'
ID100889
Institutional Source Beutler Lab
Gene Symbol Palb2
Ensembl Gene ENSMUSG00000044702
Gene Namepartner and localizer of BRCA2
Synonyms
MMRRC Submission 039264-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1192 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location122107262-122132985 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 122128209 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 146 (T146M)
Ref Sequence ENSEMBL: ENSMUSP00000102077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033156] [ENSMUST00000063587] [ENSMUST00000098068] [ENSMUST00000106468] [ENSMUST00000106469] [ENSMUST00000131657] [ENSMUST00000142952] [ENSMUST00000176193]
Predicted Effect probably benign
Transcript: ENSMUST00000033156
SMART Domains Protein: ENSMUSP00000033156
Gene: ENSMUSG00000030868

DomainStartEndE-ValueType
Pfam:Hexapep 84 118 1.3e-6 PFAM
Pfam:Hexapep 100 130 7.5e-7 PFAM
Pfam:Hexapep 107 142 7.7e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063587
SMART Domains Protein: ENSMUSP00000063514
Gene: ENSMUSG00000044702

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
PDB:3EU7|A 36 383 N/A PDB
SCOP:d2bbkh_ 231 381 4e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098068
AA Change: T146M

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000095675
Gene: ENSMUSG00000044702
AA Change: T146M

DomainStartEndE-ValueType
coiled coil region 9 46 N/A INTRINSIC
low complexity region 415 431 N/A INTRINSIC
low complexity region 446 462 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
low complexity region 543 559 N/A INTRINSIC
Pfam:PALB2_WD40 755 1102 2.4e-183 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106468
AA Change: T146M

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000102076
Gene: ENSMUSG00000044702
AA Change: T146M

DomainStartEndE-ValueType
coiled coil region 9 46 N/A INTRINSIC
low complexity region 415 431 N/A INTRINSIC
low complexity region 446 462 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
low complexity region 543 559 N/A INTRINSIC
PDB:3EU7|A 753 984 1e-131 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000106469
AA Change: T146M

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000102077
Gene: ENSMUSG00000044702
AA Change: T146M

DomainStartEndE-ValueType
coiled coil region 9 46 N/A INTRINSIC
low complexity region 180 196 N/A INTRINSIC
PDB:3EU7|A 390 740 N/A PDB
SCOP:d2bbkh_ 588 738 3e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130149
SMART Domains Protein: ENSMUSP00000121994
Gene: ENSMUSG00000044702

DomainStartEndE-ValueType
coiled coil region 9 46 N/A INTRINSIC
low complexity region 415 431 N/A INTRINSIC
low complexity region 446 462 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131657
Predicted Effect probably benign
Transcript: ENSMUST00000142952
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162843
Predicted Effect probably benign
Transcript: ENSMUST00000176193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205352
Meta Mutation Damage Score 0.0664 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may function in tumor suppression. This protein binds to and colocalizes with the breast cancer 2 early onset protein (BRCA2) in nuclear foci and likely permits the stable intranuclear localization and accumulation of BRCA2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality with impaired inner cell mass proliferation, impaired gastrulation, absence of the amnion, somites and tail bud, and general improper organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahrr T A 13: 74,214,403 M326L probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ankmy1 T C 1: 92,883,894 T591A probably damaging Het
Anks4b A T 7: 120,174,066 I50L probably benign Het
Arhgef3 C A 14: 27,379,706 T133N probably damaging Het
Arrdc1 T C 2: 24,926,140 I284V probably benign Het
Ccdc88a T A 11: 29,504,049 D717E possibly damaging Het
Cdh22 A T 2: 165,135,283 F439I probably damaging Het
Creld1 G T 6: 113,489,479 C169F probably damaging Het
Ctsq T A 13: 61,039,045 N78I probably damaging Het
Eif4g3 T A 4: 138,171,186 H1089Q probably damaging Het
Eri2 G T 7: 119,792,317 D41E probably damaging Het
Exosc9 C T 3: 36,552,755 probably benign Het
Galnt14 C T 17: 73,545,138 probably benign Het
Gen1 C T 12: 11,255,218 G192D probably damaging Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ints14 T C 9: 64,966,763 V99A possibly damaging Het
Iqsec1 G A 6: 90,671,976 probably benign Het
Jarid2 G T 13: 44,906,545 R713L probably damaging Het
Nans T C 4: 46,502,430 probably benign Het
Nkiras2 T C 11: 100,625,980 probably null Het
Obscn A T 11: 59,067,199 D3558E probably benign Het
Olfr798 C T 10: 129,626,037 S8N probably benign Het
Pcgf3 T C 5: 108,486,188 V104A probably benign Het
Polr3e A G 7: 120,933,308 D189G probably benign Het
Rfc1 T C 5: 65,293,911 K278R probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Shcbp1l T A 1: 153,425,507 I95N possibly damaging Het
Shox2 G A 3: 66,973,910 Q246* probably null Het
Slc16a4 G C 3: 107,298,873 E86D probably benign Het
Tubgcp2 A G 7: 140,029,838 V202A probably benign Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Other mutations in Palb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Palb2 APN 7 122121048 splice site probably benign
IGL00232:Palb2 APN 7 122121064 missense probably damaging 0.99
IGL02171:Palb2 APN 7 122107586 missense probably damaging 1.00
IGL03030:Palb2 APN 7 122113256 missense probably damaging 1.00
IGL03102:Palb2 APN 7 122124499 missense possibly damaging 0.88
R0128:Palb2 UTSW 7 122128166 nonsense probably null
R1470:Palb2 UTSW 7 122107523 missense probably benign 0.01
R1470:Palb2 UTSW 7 122107524 nonsense probably null
R1470:Palb2 UTSW 7 122107523 missense probably benign 0.01
R1470:Palb2 UTSW 7 122107524 nonsense probably null
R1575:Palb2 UTSW 7 122110838 splice site probably null
R1664:Palb2 UTSW 7 122124392 utr 3 prime probably benign
R1852:Palb2 UTSW 7 122114314 missense possibly damaging 0.93
R1984:Palb2 UTSW 7 122127080 missense probably damaging 0.96
R2061:Palb2 UTSW 7 122124525 missense possibly damaging 0.86
R2121:Palb2 UTSW 7 122127781 missense possibly damaging 0.61
R2877:Palb2 UTSW 7 122114429 missense probably damaging 0.97
R2878:Palb2 UTSW 7 122114429 missense probably damaging 0.97
R3923:Palb2 UTSW 7 122117360 splice site probably null
R4609:Palb2 UTSW 7 122124723 missense probably benign 0.16
R4629:Palb2 UTSW 7 122127966 missense possibly damaging 0.89
R4678:Palb2 UTSW 7 122127366 missense probably damaging 0.99
R5111:Palb2 UTSW 7 122117305 nonsense probably null
R5381:Palb2 UTSW 7 122128413 missense probably benign 0.06
R5470:Palb2 UTSW 7 122114351 missense probably damaging 1.00
R5793:Palb2 UTSW 7 122127637 missense probably benign 0.05
R6160:Palb2 UTSW 7 122128420 unclassified probably null
R6630:Palb2 UTSW 7 122124529 missense probably damaging 0.97
R6783:Palb2 UTSW 7 122127488 missense probably damaging 1.00
R6897:Palb2 UTSW 7 122127047 critical splice donor site probably null
X0060:Palb2 UTSW 7 122114478 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGCTGTTTGACGCAGTACATGAAGG -3'
(R):5'- TGTGACACATTGCAAAGCAACCATC -3'

Sequencing Primer
(F):5'- CCAATTCCTGTAACAAGTGCTGG -3'
(R):5'- TCTGGATGAGGAGACTGGAG -3'
Posted On2014-01-15