Incidental Mutation 'R1192:Tubgcp2'
ID100890
Institutional Source Beutler Lab
Gene Symbol Tubgcp2
Ensembl Gene ENSMUSG00000025474
Gene Nametubulin, gamma complex associated protein 2
Synonyms1700022B05Rik
MMRRC Submission 039264-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R1192 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location139995955-140036669 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140029838 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 202 (V202A)
Ref Sequence ENSEMBL: ENSMUSP00000147329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026547] [ENSMUST00000209574] [ENSMUST00000210224] [ENSMUST00000211261] [ENSMUST00000211638]
Predicted Effect probably benign
Transcript: ENSMUST00000026547
AA Change: V202A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026547
Gene: ENSMUSG00000025474
AA Change: V202A

DomainStartEndE-ValueType
low complexity region 109 121 N/A INTRINSIC
Pfam:Spc97_Spc98 220 738 8.6e-123 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209574
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209930
Predicted Effect probably benign
Transcript: ENSMUST00000210224
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211186
Predicted Effect probably benign
Transcript: ENSMUST00000211261
Predicted Effect probably benign
Transcript: ENSMUST00000211638
AA Change: V202A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0968 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency 97% (32/33)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahrr T A 13: 74,214,403 M326L probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ankmy1 T C 1: 92,883,894 T591A probably damaging Het
Anks4b A T 7: 120,174,066 I50L probably benign Het
Arhgef3 C A 14: 27,379,706 T133N probably damaging Het
Arrdc1 T C 2: 24,926,140 I284V probably benign Het
Ccdc88a T A 11: 29,504,049 D717E possibly damaging Het
Cdh22 A T 2: 165,135,283 F439I probably damaging Het
Creld1 G T 6: 113,489,479 C169F probably damaging Het
Ctsq T A 13: 61,039,045 N78I probably damaging Het
Eif4g3 T A 4: 138,171,186 H1089Q probably damaging Het
Eri2 G T 7: 119,792,317 D41E probably damaging Het
Exosc9 C T 3: 36,552,755 probably benign Het
Galnt14 C T 17: 73,545,138 probably benign Het
Gen1 C T 12: 11,255,218 G192D probably damaging Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ints14 T C 9: 64,966,763 V99A possibly damaging Het
Iqsec1 G A 6: 90,671,976 probably benign Het
Jarid2 G T 13: 44,906,545 R713L probably damaging Het
Nans T C 4: 46,502,430 probably benign Het
Nkiras2 T C 11: 100,625,980 probably null Het
Obscn A T 11: 59,067,199 D3558E probably benign Het
Olfr798 C T 10: 129,626,037 S8N probably benign Het
Palb2 G A 7: 122,128,209 T146M probably benign Het
Pcgf3 T C 5: 108,486,188 V104A probably benign Het
Polr3e A G 7: 120,933,308 D189G probably benign Het
Rfc1 T C 5: 65,293,911 K278R probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Shcbp1l T A 1: 153,425,507 I95N possibly damaging Het
Shox2 G A 3: 66,973,910 Q246* probably null Het
Slc16a4 G C 3: 107,298,873 E86D probably benign Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Other mutations in Tubgcp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Tubgcp2 APN 7 140031022 missense possibly damaging 0.58
IGL00791:Tubgcp2 APN 7 140001498 missense probably damaging 0.97
IGL02643:Tubgcp2 APN 7 139996154 missense probably damaging 1.00
IGL02710:Tubgcp2 APN 7 140004984 splice site probably benign
IGL03352:Tubgcp2 APN 7 140001027 missense probably benign 0.01
R0189:Tubgcp2 UTSW 7 140001605 splice site probably benign
R0333:Tubgcp2 UTSW 7 139999347 missense probably damaging 1.00
R0379:Tubgcp2 UTSW 7 140032192 missense probably damaging 1.00
R1051:Tubgcp2 UTSW 7 139998896 missense probably benign 0.26
R1528:Tubgcp2 UTSW 7 140033783 unclassified probably benign
R1728:Tubgcp2 UTSW 7 139998055 missense probably benign
R1729:Tubgcp2 UTSW 7 139998055 missense probably benign
R1784:Tubgcp2 UTSW 7 139998055 missense probably benign
R1888:Tubgcp2 UTSW 7 139999270 missense probably damaging 1.00
R1888:Tubgcp2 UTSW 7 140006156 missense probably damaging 1.00
R1888:Tubgcp2 UTSW 7 139999270 missense probably damaging 1.00
R1888:Tubgcp2 UTSW 7 140006156 missense probably damaging 1.00
R1967:Tubgcp2 UTSW 7 140006153 missense probably benign 0.09
R4514:Tubgcp2 UTSW 7 139996071 missense possibly damaging 0.51
R4545:Tubgcp2 UTSW 7 139996071 missense possibly damaging 0.51
R4774:Tubgcp2 UTSW 7 139996161 missense probably damaging 1.00
R4790:Tubgcp2 UTSW 7 139999288 missense probably damaging 1.00
R5114:Tubgcp2 UTSW 7 140007441 missense possibly damaging 0.91
R5435:Tubgcp2 UTSW 7 139996072 missense possibly damaging 0.51
R5531:Tubgcp2 UTSW 7 140005024 intron probably null
R5699:Tubgcp2 UTSW 7 139998788 missense possibly damaging 0.53
R5706:Tubgcp2 UTSW 7 140032225 nonsense probably null
R6123:Tubgcp2 UTSW 7 140007597 missense probably damaging 1.00
R7153:Tubgcp2 UTSW 7 140001036 missense not run
X0004:Tubgcp2 UTSW 7 140007021 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GAAAGTGTGACCTCCTGGTCCTTG -3'
(R):5'- GCTCTCTTGTTCTTAGGCCCAGATG -3'

Sequencing Primer
(F):5'- GGTCCTTGTGTCACACACTG -3'
(R):5'- TTCCCAGCATGGGTGTATGA -3'
Posted On2014-01-15