Incidental Mutation 'R1192:Ahrr'
ID100909
Institutional Source Beutler Lab
Gene Symbol Ahrr
Ensembl Gene ENSMUSG00000021575
Gene Namearyl-hydrocarbon receptor repressor
Synonyms
MMRRC Submission 039264-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1192 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location74211118-74292331 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74214403 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 326 (M326L)
Ref Sequence ENSEMBL: ENSMUSP00000105268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022059] [ENSMUST00000109640]
Predicted Effect probably benign
Transcript: ENSMUST00000022059
AA Change: M454L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022059
Gene: ENSMUSG00000021575
AA Change: M454L

DomainStartEndE-ValueType
HLH 32 86 1.1e-11 SMART
PAS 108 174 6.6e-14 SMART
low complexity region 236 250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109640
AA Change: M326L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105268
Gene: ENSMUSG00000021575
AA Change: M326L

DomainStartEndE-ValueType
Blast:PAS 1 46 1e-27 BLAST
PDB:4M4X|B 1 142 2e-30 PDB
SCOP:d1jnua_ 2 63 7e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148438
Meta Mutation Damage Score 0.1164 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: This gene encodes a protein that represses aryl hydrocarbon receptor-dependent signaling. The encoded protein competes with the aryl hydrocarbon receptor transcription factor for heterodimerization with the aryl hydrocarbon receptor nuclear translocator protein and binding to xenobiotic response element (XRE) sequence in many genes. This protein is implicated in the regulation of cell growth and differentiation as well as mediating dioxin toxicity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased susceptibility to chemically induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ankmy1 T C 1: 92,883,894 T591A probably damaging Het
Anks4b A T 7: 120,174,066 I50L probably benign Het
Arhgef3 C A 14: 27,379,706 T133N probably damaging Het
Arrdc1 T C 2: 24,926,140 I284V probably benign Het
Ccdc88a T A 11: 29,504,049 D717E possibly damaging Het
Cdh22 A T 2: 165,135,283 F439I probably damaging Het
Creld1 G T 6: 113,489,479 C169F probably damaging Het
Ctsq T A 13: 61,039,045 N78I probably damaging Het
Eif4g3 T A 4: 138,171,186 H1089Q probably damaging Het
Eri2 G T 7: 119,792,317 D41E probably damaging Het
Exosc9 C T 3: 36,552,755 probably benign Het
Galnt14 C T 17: 73,545,138 probably benign Het
Gen1 C T 12: 11,255,218 G192D probably damaging Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ints14 T C 9: 64,966,763 V99A possibly damaging Het
Iqsec1 G A 6: 90,671,976 probably benign Het
Jarid2 G T 13: 44,906,545 R713L probably damaging Het
Nans T C 4: 46,502,430 probably benign Het
Nkiras2 T C 11: 100,625,980 probably null Het
Obscn A T 11: 59,067,199 D3558E probably benign Het
Olfr798 C T 10: 129,626,037 S8N probably benign Het
Palb2 G A 7: 122,128,209 T146M probably benign Het
Pcgf3 T C 5: 108,486,188 V104A probably benign Het
Polr3e A G 7: 120,933,308 D189G probably benign Het
Rfc1 T C 5: 65,293,911 K278R probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Shcbp1l T A 1: 153,425,507 I95N possibly damaging Het
Shox2 G A 3: 66,973,910 Q246* probably null Het
Slc16a4 G C 3: 107,298,873 E86D probably benign Het
Tubgcp2 A G 7: 140,029,838 V202A probably benign Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Other mutations in Ahrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02116:Ahrr APN 13 74220573 missense possibly damaging 0.52
IGL03143:Ahrr APN 13 74257495 nonsense probably null
calico_jack UTSW 13 74222912 missense possibly damaging 0.51
R0009:Ahrr UTSW 13 74283024 splice site probably benign
R0010:Ahrr UTSW 13 74283024 splice site probably benign
R0010:Ahrr UTSW 13 74283024 splice site probably benign
R0040:Ahrr UTSW 13 74283024 splice site probably benign
R0079:Ahrr UTSW 13 74283024 splice site probably benign
R0082:Ahrr UTSW 13 74283024 splice site probably benign
R0164:Ahrr UTSW 13 74283024 splice site probably benign
R0165:Ahrr UTSW 13 74283024 splice site probably benign
R0167:Ahrr UTSW 13 74283024 splice site probably benign
R0310:Ahrr UTSW 13 74283024 splice site probably benign
R0344:Ahrr UTSW 13 74214586 missense probably damaging 1.00
R0948:Ahrr UTSW 13 74213769 missense probably damaging 1.00
R1438:Ahrr UTSW 13 74224868 nonsense probably null
R1532:Ahrr UTSW 13 74213707 missense probably benign 0.01
R1600:Ahrr UTSW 13 74214378 missense probably benign 0.00
R2302:Ahrr UTSW 13 74277661 missense probably damaging 1.00
R3055:Ahrr UTSW 13 74224887 missense probably damaging 1.00
R4683:Ahrr UTSW 13 74224766 splice site silent
R4717:Ahrr UTSW 13 74215766 missense probably benign 0.03
R4769:Ahrr UTSW 13 74214212 missense probably damaging 1.00
R5998:Ahrr UTSW 13 74213836 missense probably damaging 0.99
R6225:Ahrr UTSW 13 74222912 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- AGTGACAATACTGGGTTGCATGGAG -3'
(R):5'- ACACTTGAGGCACCTGAACTGGAG -3'

Sequencing Primer
(F):5'- TGTAGAAAATCCCCGAGCTGTG -3'
(R):5'- CACCTGAACTGGAGCACAG -3'
Posted On2014-01-15