Incidental Mutation 'R1192:Arhgef3'
ID100911
Institutional Source Beutler Lab
Gene Symbol Arhgef3
Ensembl Gene ENSMUSG00000021895
Gene NameRho guanine nucleotide exchange factor (GEF) 3
Synonyms9830169H03Rik, 1200004I24Rik, C76747
MMRRC Submission 039264-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R1192 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location27114899-27403911 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 27379706 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 133 (T133N)
Ref Sequence ENSEMBL: ENSMUSP00000153396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049206] [ENSMUST00000224981] [ENSMUST00000225949]
Predicted Effect probably damaging
Transcript: ENSMUST00000049206
AA Change: T113N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046486
Gene: ENSMUSG00000021895
AA Change: T113N

DomainStartEndE-ValueType
RhoGEF 132 309 4.11e-51 SMART
PH 318 457 3.26e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175293
Predicted Effect possibly damaging
Transcript: ENSMUST00000224981
AA Change: T106N

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225494
Predicted Effect probably damaging
Transcript: ENSMUST00000225949
AA Change: T133N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.33 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho-like GTPases are involved in a variety of cellular processes, and they are activated by binding GTP and inactivated by conversion of GTP to GDP by their intrinsic GTPase activity. Guanine nucleotide exchange factors (GEFs) accelerate the GTPase activity of Rho GTPases by catalyzing their release of bound GDP. This gene encodes a guanine nucleotide exchange factor, which specifically activates two members of the Rho GTPase family: RHOA and RHOB, both of which have a role in bone cell biology. It has been identified that genetic variation in this gene plays a role in the determination of bone mineral density (BMD), indicating the implication of this gene in postmenopausal osteoporosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased mean platelet volume and a mild delay in platelet recovery in response to thrombocytopenia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahrr T A 13: 74,214,403 M326L probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ankmy1 T C 1: 92,883,894 T591A probably damaging Het
Anks4b A T 7: 120,174,066 I50L probably benign Het
Arrdc1 T C 2: 24,926,140 I284V probably benign Het
Ccdc88a T A 11: 29,504,049 D717E possibly damaging Het
Cdh22 A T 2: 165,135,283 F439I probably damaging Het
Creld1 G T 6: 113,489,479 C169F probably damaging Het
Ctsq T A 13: 61,039,045 N78I probably damaging Het
Eif4g3 T A 4: 138,171,186 H1089Q probably damaging Het
Eri2 G T 7: 119,792,317 D41E probably damaging Het
Exosc9 C T 3: 36,552,755 probably benign Het
Galnt14 C T 17: 73,545,138 probably benign Het
Gen1 C T 12: 11,255,218 G192D probably damaging Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ints14 T C 9: 64,966,763 V99A possibly damaging Het
Iqsec1 G A 6: 90,671,976 probably benign Het
Jarid2 G T 13: 44,906,545 R713L probably damaging Het
Nans T C 4: 46,502,430 probably benign Het
Nkiras2 T C 11: 100,625,980 probably null Het
Obscn A T 11: 59,067,199 D3558E probably benign Het
Olfr798 C T 10: 129,626,037 S8N probably benign Het
Palb2 G A 7: 122,128,209 T146M probably benign Het
Pcgf3 T C 5: 108,486,188 V104A probably benign Het
Polr3e A G 7: 120,933,308 D189G probably benign Het
Rfc1 T C 5: 65,293,911 K278R probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Shcbp1l T A 1: 153,425,507 I95N possibly damaging Het
Shox2 G A 3: 66,973,910 Q246* probably null Het
Slc16a4 G C 3: 107,298,873 E86D probably benign Het
Tubgcp2 A G 7: 140,029,838 V202A probably benign Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Other mutations in Arhgef3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Arhgef3 APN 14 27401919 nonsense probably null
IGL02178:Arhgef3 APN 14 27265529 nonsense probably null
IGL02302:Arhgef3 APN 14 27362842 missense probably benign 0.08
IGL02505:Arhgef3 APN 14 27394000 missense possibly damaging 0.92
IGL03203:Arhgef3 APN 14 27394116 missense probably damaging 1.00
IGL03339:Arhgef3 APN 14 27401857 missense probably damaging 0.99
R0762:Arhgef3 UTSW 14 27397627 missense probably damaging 1.00
R1572:Arhgef3 UTSW 14 27401735 missense probably damaging 1.00
R1794:Arhgef3 UTSW 14 27397605 missense probably benign 0.44
R2426:Arhgef3 UTSW 14 27384181 nonsense probably null
R2509:Arhgef3 UTSW 14 27379676 missense probably damaging 1.00
R4932:Arhgef3 UTSW 14 27384213 missense probably damaging 0.99
R5017:Arhgef3 UTSW 14 27265530 missense possibly damaging 0.85
R5216:Arhgef3 UTSW 14 27401842 missense probably benign 0.00
R6562:Arhgef3 UTSW 14 27152996 start gained probably benign
R6951:Arhgef3 UTSW 14 27144018 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGAGCTGCCTTTTGTGTGAGCC -3'
(R):5'- TGTGAGTGGATGAATCCTAACCGGAC -3'

Sequencing Primer
(F):5'- GAGGGTTCCCACTCCTTAAAAG -3'
(R):5'- TGAATCCTAACCGGACACTTAGC -3'
Posted On2014-01-15