Incidental Mutation 'R1193:Shf'
ID100923
Institutional Source Beutler Lab
Gene Symbol Shf
Ensembl Gene ENSMUSG00000033256
Gene NameSrc homology 2 domain containing F
Synonyms
MMRRC Submission 039265-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R1193 (G1)
Quality Score119
Status Not validated
Chromosome2
Chromosomal Location122348892-122369162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 122368682 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 51 (P51S)
Ref Sequence ENSEMBL: ENSMUSP00000106161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048635] [ENSMUST00000110531] [ENSMUST00000110532] [ENSMUST00000125826]
Predicted Effect probably benign
Transcript: ENSMUST00000048635
SMART Domains Protein: ENSMUSP00000045135
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 48 67 N/A INTRINSIC
SH2 136 220 9.16e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110531
SMART Domains Protein: ENSMUSP00000106160
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 48 67 N/A INTRINSIC
SH2 136 220 9.16e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110532
AA Change: P51S

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106161
Gene: ENSMUSG00000033256
AA Change: P51S

DomainStartEndE-ValueType
low complexity region 19 38 N/A INTRINSIC
low complexity region 45 61 N/A INTRINSIC
low complexity region 77 87 N/A INTRINSIC
low complexity region 146 165 N/A INTRINSIC
Blast:SH2 225 278 2e-22 BLAST
SCOP:d1ayaa_ 237 291 1e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125826
AA Change: P161S

PolyPhen 2 Score 0.433 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117099
Gene: ENSMUSG00000033256
AA Change: P161S

DomainStartEndE-ValueType
low complexity region 14 56 N/A INTRINSIC
low complexity region 76 105 N/A INTRINSIC
low complexity region 129 148 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
low complexity region 187 197 N/A INTRINSIC
low complexity region 256 275 N/A INTRINSIC
SH2 344 428 9.16e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151130
AA Change: P152S

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114524
Gene: ENSMUSG00000033256
AA Change: P152S

DomainStartEndE-ValueType
low complexity region 6 48 N/A INTRINSIC
low complexity region 68 97 N/A INTRINSIC
low complexity region 121 140 N/A INTRINSIC
low complexity region 147 163 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
low complexity region 248 267 N/A INTRINSIC
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.5%
  • 20x: 86.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a A G 3: 32,712,144 D49G probably benign Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Gpm6a A T 8: 55,047,233 probably null Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nudt5 G A 2: 5,863,600 S103N probably benign Het
Olfr1336 A G 7: 6,460,716 N69S probably benign Het
Olfr1431 A T 19: 12,210,439 Y291F probably damaging Het
Pds5a G T 5: 65,637,802 A697E probably damaging Het
Pik3ca A G 3: 32,456,093 D806G probably damaging Het
Rars C T 11: 35,809,326 A548T possibly damaging Het
Rfk C T 19: 17,395,321 P69L probably damaging Het
Sp4 C T 12: 118,299,246 R355H possibly damaging Het
Tcaim T C 9: 122,818,830 Y137H probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tmem150c T C 5: 100,083,592 T175A probably damaging Het
Twnk A G 19: 45,007,790 K221E probably damaging Het
Vmn2r67 T C 7: 85,151,445 K428E probably damaging Het
Vmn2r82 T A 10: 79,377,905 Y108* probably null Het
Wwox G A 8: 114,679,874 V202M probably benign Het
Other mutations in Shf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02726:Shf APN 2 122359488 missense probably damaging 1.00
FR4589:Shf UTSW 2 122354177 small insertion probably benign
R0624:Shf UTSW 2 122368635 splice site probably benign
R0993:Shf UTSW 2 122368682 missense probably damaging 0.96
R1180:Shf UTSW 2 122368682 missense probably damaging 0.96
R1181:Shf UTSW 2 122368682 missense probably damaging 0.96
R1194:Shf UTSW 2 122368682 missense probably damaging 0.96
R1195:Shf UTSW 2 122368682 missense probably damaging 0.96
R1195:Shf UTSW 2 122368682 missense probably damaging 0.96
R1257:Shf UTSW 2 122368682 missense probably damaging 0.96
R1258:Shf UTSW 2 122368682 missense probably damaging 0.96
R1260:Shf UTSW 2 122368682 missense probably damaging 0.96
R1267:Shf UTSW 2 122368682 missense probably damaging 0.96
R1268:Shf UTSW 2 122368682 missense probably damaging 0.96
R1269:Shf UTSW 2 122368682 missense probably damaging 0.96
R1270:Shf UTSW 2 122368682 missense probably damaging 0.96
R1271:Shf UTSW 2 122368682 missense probably damaging 0.96
R1273:Shf UTSW 2 122368682 missense probably damaging 0.96
R1388:Shf UTSW 2 122368682 missense probably damaging 0.96
R1448:Shf UTSW 2 122368682 missense probably damaging 0.96
R1494:Shf UTSW 2 122368682 missense probably damaging 0.96
R1615:Shf UTSW 2 122349432 missense probably damaging 1.00
R1697:Shf UTSW 2 122368682 missense probably damaging 0.96
R1756:Shf UTSW 2 122368682 missense probably damaging 0.96
R1820:Shf UTSW 2 122368682 missense probably damaging 0.96
R1950:Shf UTSW 2 122368682 missense probably damaging 0.96
R3732:Shf UTSW 2 122345207 unclassified probably benign
R6794:Shf UTSW 2 122353840 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTAACAGGAAACAGGGCAGAGTT -3'
(R):5'- CAGCGGTGGAGTCGCAAAGT -3'

Sequencing Primer
(F):5'- GGTTAAAATTTGAGCCCCCG -3'
(R):5'- GAGCACCTGGGCTTTCG -3'
Posted On2014-01-15