Incidental Mutation 'R1193:Olfr1336'
ID100939
Institutional Source Beutler Lab
Gene Symbol Olfr1336
Ensembl Gene ENSMUSG00000048620
Gene Nameolfactory receptor 1336
SynonymsGA_x6K02T2QGBW-3190370-3191314, MOR103-7
MMRRC Submission 039265-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R1193 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location6456168-6466817 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6460716 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 69 (N69S)
Ref Sequence ENSEMBL: ENSMUSP00000150162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056120] [ENSMUST00000214301]
Predicted Effect probably benign
Transcript: ENSMUST00000056120
AA Change: N69S

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000056956
Gene: ENSMUSG00000048620
AA Change: N69S

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 3.2e-52 PFAM
Pfam:7tm_1 45 294 2.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214301
AA Change: N69S

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.5%
  • 20x: 86.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a A G 3: 32,712,144 D49G probably benign Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Gpm6a A T 8: 55,047,233 probably null Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nudt5 G A 2: 5,863,600 S103N probably benign Het
Olfr1431 A T 19: 12,210,439 Y291F probably damaging Het
Pds5a G T 5: 65,637,802 A697E probably damaging Het
Pik3ca A G 3: 32,456,093 D806G probably damaging Het
Rars C T 11: 35,809,326 A548T possibly damaging Het
Rfk C T 19: 17,395,321 P69L probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sp4 C T 12: 118,299,246 R355H possibly damaging Het
Tcaim T C 9: 122,818,830 Y137H probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tmem150c T C 5: 100,083,592 T175A probably damaging Het
Twnk A G 19: 45,007,790 K221E probably damaging Het
Vmn2r67 T C 7: 85,151,445 K428E probably damaging Het
Vmn2r82 T A 10: 79,377,905 Y108* probably null Het
Wwox G A 8: 114,679,874 V202M probably benign Het
Other mutations in Olfr1336
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01889:Olfr1336 APN 7 6460503 splice site probably benign
IGL02730:Olfr1336 APN 7 6461124 missense possibly damaging 0.75
R1582:Olfr1336 UTSW 7 6460814 missense probably benign 0.02
R1616:Olfr1336 UTSW 7 6460745 missense probably damaging 1.00
R1954:Olfr1336 UTSW 7 6461145 missense probably benign 0.11
R2889:Olfr1336 UTSW 7 6460941 missense probably damaging 1.00
R4881:Olfr1336 UTSW 7 6460754 missense probably benign 0.01
R4958:Olfr1336 UTSW 7 6461058 missense probably damaging 1.00
R5849:Olfr1336 UTSW 7 6460994 missense possibly damaging 0.46
R6253:Olfr1336 UTSW 7 6460548 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGACCAGAGTCCAGGAGTTTGTCC -3'
(R):5'- TTTGATCACTGAGACCAGCAGCC -3'

Sequencing Primer
(F):5'- CTATTGGGCTTGTCCACAAGG -3'
(R):5'- GGCCACATAGCGGTCATAAG -3'
Posted On2014-01-15