Incidental Mutation 'R1193:Gpm6a'
ID100943
Institutional Source Beutler Lab
Gene Symbol Gpm6a
Ensembl Gene ENSMUSG00000031517
Gene Nameglycoprotein m6a
SynonymsM6A, Gpm6
MMRRC Submission 039265-MU
Accession Numbers

Genbank: NM_153581; MGI: 107671

Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R1193 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location54954843-55060871 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 55047233 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000033915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033915]
Predicted Effect probably null
Transcript: ENSMUST00000033915
SMART Domains Protein: ENSMUSP00000033915
Gene: ENSMUSG00000031517

DomainStartEndE-ValueType
PLP 157 212 1.28e-31 SMART
low complexity region 213 227 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209917
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.5%
  • 20x: 86.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in increased percentage of total body fat and total body fat mass. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a A G 3: 32,712,144 D49G probably benign Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nudt5 G A 2: 5,863,600 S103N probably benign Het
Olfr1336 A G 7: 6,460,716 N69S probably benign Het
Olfr1431 A T 19: 12,210,439 Y291F probably damaging Het
Pds5a G T 5: 65,637,802 A697E probably damaging Het
Pik3ca A G 3: 32,456,093 D806G probably damaging Het
Rars C T 11: 35,809,326 A548T possibly damaging Het
Rfk C T 19: 17,395,321 P69L probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sp4 C T 12: 118,299,246 R355H possibly damaging Het
Tcaim T C 9: 122,818,830 Y137H probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tmem150c T C 5: 100,083,592 T175A probably damaging Het
Twnk A G 19: 45,007,790 K221E probably damaging Het
Vmn2r67 T C 7: 85,151,445 K428E probably damaging Het
Vmn2r82 T A 10: 79,377,905 Y108* probably null Het
Wwox G A 8: 114,679,874 V202M probably benign Het
Other mutations in Gpm6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01957:Gpm6a APN 8 55050177 missense probably benign
IGL02591:Gpm6a APN 8 55058919 missense probably damaging 1.00
IGL03257:Gpm6a APN 8 55037472 missense probably damaging 1.00
F2404:Gpm6a UTSW 8 55058882 missense probably damaging 1.00
R0533:Gpm6a UTSW 8 55055374 critical splice acceptor site probably null
R0827:Gpm6a UTSW 8 55058883 missense probably damaging 1.00
R1468:Gpm6a UTSW 8 55037350 missense probably damaging 0.98
R1468:Gpm6a UTSW 8 55037350 missense probably damaging 0.98
R1793:Gpm6a UTSW 8 55054832 missense probably benign 0.13
R1879:Gpm6a UTSW 8 55037330 missense probably damaging 1.00
R2157:Gpm6a UTSW 8 55058798 missense probably damaging 0.99
R4306:Gpm6a UTSW 8 55047393 critical splice donor site probably null
R4307:Gpm6a UTSW 8 55047393 critical splice donor site probably null
R4417:Gpm6a UTSW 8 55050188 missense probably damaging 1.00
R6058:Gpm6a UTSW 8 55058798 missense probably damaging 0.99
R6112:Gpm6a UTSW 8 55054810 missense probably benign
R6254:Gpm6a UTSW 8 55047396 splice site probably null
R7065:Gpm6a UTSW 8 55037458 missense probably benign 0.13
R7076:Gpm6a UTSW 8 55037451 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGCAGACATTAGGCTGTTCTTC -3'
(R):5'- CCCATGTTTCATGCTGAGTGCAGAG -3'

Sequencing Primer
(F):5'- accttcctccactcttccc -3'
(R):5'- TTCATGCTGAGTGCAGAGAAATAAC -3'
Posted On2014-01-15