Incidental Mutation 'R1195:Cyb5d1'
ID101069
Institutional Source Beutler Lab
Gene Symbol Cyb5d1
Ensembl Gene ENSMUSG00000044795
Gene Namecytochrome b5 domain containing 1
SynonymsLOC327951
MMRRC Submission 039267-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1195 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69391925-69395631 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 69394971 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050140] [ENSMUST00000051620] [ENSMUST00000051620] [ENSMUST00000094077] [ENSMUST00000108660] [ENSMUST00000108660] [ENSMUST00000144531]
Predicted Effect probably benign
Transcript: ENSMUST00000050140
SMART Domains Protein: ENSMUSP00000055528
Gene: ENSMUSG00000045377

DomainStartEndE-ValueType
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000051620
SMART Domains Protein: ENSMUSP00000059709
Gene: ENSMUSG00000044795

DomainStartEndE-ValueType
Cyt-b5 20 92 1.89e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000051620
SMART Domains Protein: ENSMUSP00000059709
Gene: ENSMUSG00000044795

DomainStartEndE-ValueType
Cyt-b5 20 92 1.89e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082283
Predicted Effect probably benign
Transcript: ENSMUST00000094077
SMART Domains Protein: ENSMUSP00000091620
Gene: ENSMUSG00000018476

DomainStartEndE-ValueType
low complexity region 29 43 N/A INTRINSIC
low complexity region 54 71 N/A INTRINSIC
SCOP:d1elwa_ 91 152 9e-5 SMART
low complexity region 214 227 N/A INTRINSIC
low complexity region 239 270 N/A INTRINSIC
low complexity region 312 329 N/A INTRINSIC
low complexity region 333 345 N/A INTRINSIC
low complexity region 389 415 N/A INTRINSIC
low complexity region 461 487 N/A INTRINSIC
low complexity region 515 524 N/A INTRINSIC
low complexity region 544 577 N/A INTRINSIC
low complexity region 585 615 N/A INTRINSIC
low complexity region 643 650 N/A INTRINSIC
low complexity region 711 719 N/A INTRINSIC
low complexity region 743 766 N/A INTRINSIC
low complexity region 771 811 N/A INTRINSIC
low complexity region 840 879 N/A INTRINSIC
low complexity region 890 909 N/A INTRINSIC
low complexity region 950 989 N/A INTRINSIC
low complexity region 993 1011 N/A INTRINSIC
low complexity region 1044 1068 N/A INTRINSIC
low complexity region 1284 1317 N/A INTRINSIC
JmjC 1337 1500 1.61e-47 SMART
Blast:JmjC 1536 1600 1e-18 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000108660
SMART Domains Protein: ENSMUSP00000104300
Gene: ENSMUSG00000044795

DomainStartEndE-ValueType
Cyt-b5 20 92 1.89e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108660
SMART Domains Protein: ENSMUSP00000104300
Gene: ENSMUSG00000044795

DomainStartEndE-ValueType
Cyt-b5 20 92 1.89e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142126
Predicted Effect probably benign
Transcript: ENSMUST00000144531
SMART Domains Protein: ENSMUSP00000123155
Gene: ENSMUSG00000059278

DomainStartEndE-ValueType
low complexity region 18 36 N/A INTRINSIC
Sm 43 114 4.26e-15 SMART
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.1%
  • 20x: 81.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1a C A 13: 30,381,918 P322Q probably damaging Het
Amh AGCGCCTTGG AG 10: 80,805,585 probably null Het
Brd1 T C 15: 88,700,811 E940G probably benign Het
Cd28 C T 1: 60,763,144 T74I possibly damaging Het
Cntnap2 T A 6: 46,483,968 M646K probably benign Het
D430042O09Rik A G 7: 125,866,482 R1343G probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dst A G 1: 34,211,154 D4063G probably damaging Het
Elmod1 T C 9: 53,935,768 Y42C probably damaging Het
Fam129b T C 2: 32,919,803 V304A probably benign Het
Hdac5 T C 11: 102,205,506 I310V probably damaging Het
Ighv10-1 A T 12: 114,479,395 probably benign Het
Igsf3 A G 3: 101,458,103 D1130G probably benign Het
Kdm4d A G 9: 14,463,099 S488P probably benign Het
Lingo2 A G 4: 35,708,538 Y481H probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Map3k20 C T 2: 72,438,218 P523L probably damaging Het
Msx1 A G 5: 37,821,281 Y297H probably damaging Het
Myo9a A G 9: 59,895,200 D1990G probably damaging Het
Perp C A 10: 18,855,735 Y147* probably null Het
Prr16 A T 18: 51,302,683 D78V probably damaging Het
Rfx7 C T 9: 72,617,946 T806M probably damaging Het
Robo2 T C 16: 73,916,128 probably null Het
Sema5b A T 16: 35,651,660 E496V probably null Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Spdl1 T C 11: 34,819,817 Y368C probably damaging Het
Sptbn2 G C 19: 4,745,893 R1700P possibly damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tln2 T G 9: 67,258,566 K1000Q probably damaging Het
Tmbim7 A G 5: 3,661,943 T63A probably benign Het
Tmed11 T C 5: 108,779,019 D129G possibly damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Ttll6 T C 11: 96,135,729 I113T probably damaging Het
Uso1 T A 5: 92,170,747 F210L probably damaging Het
Uspl1 T A 5: 149,194,321 V224E probably benign Het
Zfp639 G A 3: 32,519,196 V86I possibly damaging Het
Other mutations in Cyb5d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Cyb5d1 APN 11 69393784 unclassified probably null
IGL01897:Cyb5d1 APN 11 69393761 missense probably benign
IGL02566:Cyb5d1 APN 11 69393768 missense probably benign 0.01
IGL02732:Cyb5d1 APN 11 69393809 splice site probably null
R0025:Cyb5d1 UTSW 11 69394966 splice site probably null
R0760:Cyb5d1 UTSW 11 69395173 missense probably benign
R1195:Cyb5d1 UTSW 11 69394971 critical splice donor site probably null
R1195:Cyb5d1 UTSW 11 69394971 critical splice donor site probably null
R1907:Cyb5d1 UTSW 11 69394740 missense probably benign 0.32
R2220:Cyb5d1 UTSW 11 69395045 missense probably benign 0.00
R3756:Cyb5d1 UTSW 11 69393832 missense probably damaging 1.00
R4757:Cyb5d1 UTSW 11 69394988 missense probably damaging 0.99
R4994:Cyb5d1 UTSW 11 69393771 missense probably damaging 1.00
R5509:Cyb5d1 UTSW 11 69393735 unclassified probably null
Predicted Primers PCR Primer
(F):5'- GGGTACGGTATCTCATGCAACCAG -3'
(R):5'- CGGTATTTCACGCCGTCAGAAGTAG -3'

Sequencing Primer
(F):5'- TCTCATGCAACCAGTGAGTG -3'
(R):5'- ATCTAACACCGCTTGTCGAGG -3'
Posted On2014-01-15