Incidental Mutation 'R1195:Ttll6'
ID101071
Institutional Source Beutler Lab
Gene Symbol Ttll6
Ensembl Gene ENSMUSG00000038756
Gene Nametubulin tyrosine ligase-like family, member 6
SynonymsD11Moh43e, t8130b59, 4932418K24Rik, D11Moh44e
MMRRC Submission 039267-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R1195 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location96133786-96165451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96135729 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 113 (I113T)
Ref Sequence ENSEMBL: ENSMUSP00000127778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107680] [ENSMUST00000167258]
Predicted Effect probably damaging
Transcript: ENSMUST00000107680
AA Change: I9T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103307
Gene: ENSMUSG00000038756
AA Change: I9T

DomainStartEndE-ValueType
Pfam:TTL 1 293 4.4e-90 PFAM
coiled coil region 376 402 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167258
AA Change: I113T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127778
Gene: ENSMUSG00000038756
AA Change: I113T

DomainStartEndE-ValueType
low complexity region 7 29 N/A INTRINSIC
low complexity region 52 59 N/A INTRINSIC
Pfam:TTL 103 397 2.9e-90 PFAM
coiled coil region 480 506 N/A INTRINSIC
Meta Mutation Damage Score 0.286 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.1%
  • 20x: 81.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1a C A 13: 30,381,918 P322Q probably damaging Het
Amh AGCGCCTTGG AG 10: 80,805,585 probably null Het
Brd1 T C 15: 88,700,811 E940G probably benign Het
Cd28 C T 1: 60,763,144 T74I possibly damaging Het
Cntnap2 T A 6: 46,483,968 M646K probably benign Het
Cyb5d1 C T 11: 69,394,971 probably null Het
D430042O09Rik A G 7: 125,866,482 R1343G probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dst A G 1: 34,211,154 D4063G probably damaging Het
Elmod1 T C 9: 53,935,768 Y42C probably damaging Het
Fam129b T C 2: 32,919,803 V304A probably benign Het
Hdac5 T C 11: 102,205,506 I310V probably damaging Het
Ighv10-1 A T 12: 114,479,395 probably benign Het
Igsf3 A G 3: 101,458,103 D1130G probably benign Het
Kdm4d A G 9: 14,463,099 S488P probably benign Het
Lingo2 A G 4: 35,708,538 Y481H probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Map3k20 C T 2: 72,438,218 P523L probably damaging Het
Msx1 A G 5: 37,821,281 Y297H probably damaging Het
Myo9a A G 9: 59,895,200 D1990G probably damaging Het
Perp C A 10: 18,855,735 Y147* probably null Het
Prr16 A T 18: 51,302,683 D78V probably damaging Het
Rfx7 C T 9: 72,617,946 T806M probably damaging Het
Robo2 T C 16: 73,916,128 probably null Het
Sema5b A T 16: 35,651,660 E496V probably null Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Spdl1 T C 11: 34,819,817 Y368C probably damaging Het
Sptbn2 G C 19: 4,745,893 R1700P possibly damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tln2 T G 9: 67,258,566 K1000Q probably damaging Het
Tmbim7 A G 5: 3,661,943 T63A probably benign Het
Tmed11 T C 5: 108,779,019 D129G possibly damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Uso1 T A 5: 92,170,747 F210L probably damaging Het
Uspl1 T A 5: 149,194,321 V224E probably benign Het
Zfp639 G A 3: 32,519,196 V86I possibly damaging Het
Other mutations in Ttll6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02152:Ttll6 APN 11 96135540 nonsense probably null
IGL02331:Ttll6 APN 11 96135747 missense probably damaging 1.00
IGL02490:Ttll6 APN 11 96156720 missense possibly damaging 0.55
IGL02551:Ttll6 APN 11 96154700 missense probably benign 0.00
IGL02618:Ttll6 APN 11 96147562 missense probably benign 0.04
IGL02712:Ttll6 APN 11 96139775 critical splice donor site probably benign
IGL02720:Ttll6 APN 11 96152073 critical splice donor site probably null
IGL02839:Ttll6 APN 11 96158820 missense probably damaging 1.00
IGL02974:Ttll6 APN 11 96156702 missense probably benign 0.06
IGL03038:Ttll6 APN 11 96151960 missense probably damaging 1.00
IGL03216:Ttll6 APN 11 96152014 missense probably benign 0.00
IGL03271:Ttll6 APN 11 96156687 missense probably benign 0.00
LCD18:Ttll6 UTSW 11 96155258 intron probably benign
R0295:Ttll6 UTSW 11 96154714 missense probably benign 0.09
R0310:Ttll6 UTSW 11 96147556 missense probably benign 0.41
R0466:Ttll6 UTSW 11 96145591 missense probably damaging 1.00
R0533:Ttll6 UTSW 11 96154756 missense probably benign 0.00
R1195:Ttll6 UTSW 11 96135729 missense probably damaging 1.00
R1195:Ttll6 UTSW 11 96135729 missense probably damaging 1.00
R1453:Ttll6 UTSW 11 96158888 missense possibly damaging 0.82
R1555:Ttll6 UTSW 11 96145582 missense probably damaging 1.00
R1860:Ttll6 UTSW 11 96138874 nonsense probably null
R1861:Ttll6 UTSW 11 96138874 nonsense probably null
R1998:Ttll6 UTSW 11 96139775 critical splice donor site probably null
R2034:Ttll6 UTSW 11 96135526 missense probably damaging 0.99
R2126:Ttll6 UTSW 11 96147532 missense probably damaging 1.00
R3722:Ttll6 UTSW 11 96133921 missense probably benign 0.00
R4684:Ttll6 UTSW 11 96153177 missense probably benign
R4747:Ttll6 UTSW 11 96145546 missense possibly damaging 0.46
R4771:Ttll6 UTSW 11 96133829 missense possibly damaging 0.53
R4955:Ttll6 UTSW 11 96138789 missense possibly damaging 0.87
R5042:Ttll6 UTSW 11 96154604 missense possibly damaging 0.95
R5910:Ttll6 UTSW 11 96135589 missense possibly damaging 0.90
R5951:Ttll6 UTSW 11 96145510 missense probably damaging 1.00
R6033:Ttll6 UTSW 11 96134887 missense probably damaging 1.00
R6033:Ttll6 UTSW 11 96134887 missense probably damaging 1.00
R6134:Ttll6 UTSW 11 96139742 missense possibly damaging 0.69
R6263:Ttll6 UTSW 11 96156545 missense probably benign
R6325:Ttll6 UTSW 11 96135505 missense probably damaging 1.00
R6395:Ttll6 UTSW 11 96156588 missense probably benign 0.05
R6453:Ttll6 UTSW 11 96158727 missense probably benign 0.00
R6681:Ttll6 UTSW 11 96138863 missense probably damaging 1.00
X0022:Ttll6 UTSW 11 96158741 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGACTGGACTCTCTATTGGACCGAC -3'
(R):5'- CGGGGAGCAGAGCAAACTTTCATC -3'

Sequencing Primer
(F):5'- ACTACTCAGTGTCACTGGAGC -3'
(R):5'- CAGAGCAAACTTTCATCCTAACTGTG -3'
Posted On2014-01-15