Incidental Mutation 'R1196:Olfr1180'
ID101097
Institutional Source Beutler Lab
Gene Symbol Olfr1180
Ensembl Gene ENSMUSG00000081836
Gene Nameolfactory receptor 1180
SynonymsMOR225-1, GA_x6K02T2Q125-49900552-49899623
MMRRC Submission 039268-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R1196 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88410649-88419151 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88412546 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 37 (N37K)
Ref Sequence ENSEMBL: ENSMUSP00000150965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099824] [ENSMUST00000216121] [ENSMUST00000217320]
Predicted Effect probably damaging
Transcript: ENSMUST00000099824
AA Change: N37K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097412
Gene: ENSMUSG00000081836
AA Change: N37K

DomainStartEndE-ValueType
Pfam:7tm_4 26 300 2.8e-47 PFAM
Pfam:7tm_1 36 282 2.6e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216121
AA Change: N37K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000217320
AA Change: N37K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.0376 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 94.9%
  • 20x: 86.8%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T C 5: 114,245,092 I2112T probably benign Het
Agtpbp1 C A 13: 59,450,318 probably benign Het
Ash1l T C 3: 88,983,316 M834T probably damaging Het
Aspg A G 12: 112,116,524 T213A possibly damaging Het
Chpf2 T C 5: 24,589,648 V272A possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ddah2 G T 17: 35,061,527 D215Y probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Fam46c T C 3: 100,473,000 T147A possibly damaging Het
Fbrsl1 T A 5: 110,374,519 M150L probably benign Het
Hmces T A 6: 87,936,182 D306E probably benign Het
Itga2 C T 13: 114,866,155 probably null Het
Jmjd1c T C 10: 67,239,236 probably benign Het
Krr1 T A 10: 111,975,657 H85Q probably benign Het
Krt83 C T 15: 101,491,433 R6Q probably benign Het
Krtap24-1 T C 16: 88,611,642 M199V probably benign Het
Krtap5-2 A T 7: 142,174,883 C353* probably null Het
Myo7a T G 7: 98,097,673 I178L possibly damaging Het
Myof G A 19: 37,910,960 T1043I probably damaging Het
Noc4l C T 5: 110,650,584 E247K probably damaging Het
Notch4 T C 17: 34,568,863 C437R probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Olfr859 A G 9: 19,808,632 I105V probably benign Het
Pank4 T C 4: 154,978,173 F584L probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Ranbp2 T A 10: 58,477,053 F1198L probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Unc13a A G 8: 71,654,986 I554T probably damaging Het
Zfc3h1 A G 10: 115,411,961 D1023G probably damaging Het
Zfp791 T A 8: 85,110,954 K94* probably null Het
Other mutations in Olfr1180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Olfr1180 APN 2 88411791 missense probably damaging 0.99
PIT4531001:Olfr1180 UTSW 2 88411760 missense probably benign 0.03
R0402:Olfr1180 UTSW 2 88412034 missense probably damaging 0.99
R1557:Olfr1180 UTSW 2 88412211 missense possibly damaging 0.65
R1695:Olfr1180 UTSW 2 88412100 missense probably damaging 0.98
R1840:Olfr1180 UTSW 2 88412067 missense probably benign 0.08
R2014:Olfr1180 UTSW 2 88412044 missense probably benign 0.03
R2042:Olfr1180 UTSW 2 88412202 missense possibly damaging 0.81
R5241:Olfr1180 UTSW 2 88412098 missense possibly damaging 0.60
R6043:Olfr1180 UTSW 2 88412245 missense probably benign 0.01
R7023:Olfr1180 UTSW 2 88412415 missense probably damaging 1.00
R7153:Olfr1180 UTSW 2 88412118 missense probably damaging 1.00
R7269:Olfr1180 UTSW 2 88412495 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GGCAACATAACGGTCATAGGCCA -3'
(R):5'- GTCTTTTCAGGGACCTGCCATGTTT -3'

Sequencing Primer
(F):5'- TAACGGTCATAGGCCATTGCTG -3'
(R):5'- GGACCTGCCATGTTTTTCTG -3'
Posted On2014-01-15