Incidental Mutation 'R1196:Noc4l'
ID101107
Institutional Source Beutler Lab
Gene Symbol Noc4l
Ensembl Gene ENSMUSG00000033294
Gene NameNOC4 like
Synonyms
MMRRC Submission 039268-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R1196 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location110648418-110653417 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 110650584 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 247 (E247K)
Ref Sequence ENSEMBL: ENSMUSP00000038263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031478] [ENSMUST00000042147]
Predicted Effect probably benign
Transcript: ENSMUST00000031478
SMART Domains Protein: ENSMUSP00000031478
Gene: ENSMUSG00000029504

DomainStartEndE-ValueType
low complexity region 50 75 N/A INTRINSIC
DEXDc 189 442 4.04e-40 SMART
HELICc 491 573 2.86e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000042147
AA Change: E247K

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038263
Gene: ENSMUSG00000033294
AA Change: E247K

DomainStartEndE-ValueType
Pfam:CBF 305 453 2.7e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123380
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124612
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136442
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136629
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145712
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150100
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199795
Meta Mutation Damage Score 0.084 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 94.9%
  • 20x: 86.8%
Validation Efficiency 97% (38/39)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T C 5: 114,245,092 I2112T probably benign Het
Agtpbp1 C A 13: 59,450,318 probably benign Het
Ash1l T C 3: 88,983,316 M834T probably damaging Het
Aspg A G 12: 112,116,524 T213A possibly damaging Het
Chpf2 T C 5: 24,589,648 V272A possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ddah2 G T 17: 35,061,527 D215Y probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Fam46c T C 3: 100,473,000 T147A possibly damaging Het
Fbrsl1 T A 5: 110,374,519 M150L probably benign Het
Hmces T A 6: 87,936,182 D306E probably benign Het
Itga2 C T 13: 114,866,155 probably null Het
Jmjd1c T C 10: 67,239,236 probably benign Het
Krr1 T A 10: 111,975,657 H85Q probably benign Het
Krt83 C T 15: 101,491,433 R6Q probably benign Het
Krtap24-1 T C 16: 88,611,642 M199V probably benign Het
Krtap5-2 A T 7: 142,174,883 C353* probably null Het
Myo7a T G 7: 98,097,673 I178L possibly damaging Het
Myof G A 19: 37,910,960 T1043I probably damaging Het
Notch4 T C 17: 34,568,863 C437R probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Olfr1180 A T 2: 88,412,546 N37K probably damaging Het
Olfr859 A G 9: 19,808,632 I105V probably benign Het
Pank4 T C 4: 154,978,173 F584L probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Ranbp2 T A 10: 58,477,053 F1198L probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Unc13a A G 8: 71,654,986 I554T probably damaging Het
Zfc3h1 A G 10: 115,411,961 D1023G probably damaging Het
Zfp791 T A 8: 85,110,954 K94* probably null Het
Other mutations in Noc4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01483:Noc4l APN 5 110648958 missense probably damaging 0.99
IGL02249:Noc4l APN 5 110653215 unclassified probably benign
PIT4280001:Noc4l UTSW 5 110651439 missense probably benign 0.38
R0326:Noc4l UTSW 5 110652375 nonsense probably null
R0544:Noc4l UTSW 5 110651123 missense possibly damaging 0.71
R1496:Noc4l UTSW 5 110650078 missense probably damaging 1.00
R1587:Noc4l UTSW 5 110653023 missense probably benign
R1699:Noc4l UTSW 5 110649847 nonsense probably null
R2113:Noc4l UTSW 5 110650559 missense possibly damaging 0.88
R2874:Noc4l UTSW 5 110649103 missense probably benign 0.00
R4080:Noc4l UTSW 5 110649872 missense probably benign 0.01
R5097:Noc4l UTSW 5 110651346 missense probably benign
R5875:Noc4l UTSW 5 110651310 critical splice donor site probably null
R6903:Noc4l UTSW 5 110649595 missense probably damaging 1.00
R7328:Noc4l UTSW 5 110648923 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ACAGGCACTTGTGAGGAAGTCAATC -3'
(R):5'- TGTCGCTATGACCAGCTTCAGACC -3'

Sequencing Primer
(F):5'- CTTGTGAGGAAGTCAATCATGAGTG -3'
(R):5'- GACCCAGTCCCTAACCTCTG -3'
Posted On2014-01-15