Incidental Mutation 'R1196:Hmces'
ID101115
Institutional Source Beutler Lab
Gene Symbol Hmces
Ensembl Gene ENSMUSG00000030060
Gene Name5-hydroxymethylcytosine (hmC) binding, ES cell specific
Synonyms8430410A17Rik
MMRRC Submission 039268-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R1196 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location87913935-87936629 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87936182 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 306 (D306E)
Ref Sequence ENSEMBL: ENSMUSP00000109236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032141] [ENSMUST00000113606]
Predicted Effect probably benign
Transcript: ENSMUST00000032141
AA Change: D306E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032141
Gene: ENSMUSG00000030060
AA Change: D306E

DomainStartEndE-ValueType
Pfam:SRAP 1 262 4.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113606
AA Change: D306E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109236
Gene: ENSMUSG00000030060
AA Change: D306E

DomainStartEndE-ValueType
Pfam:DUF159 1 263 9.4e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148914
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204614
Meta Mutation Damage Score 0.0332 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 94.9%
  • 20x: 86.8%
Validation Efficiency 97% (38/39)
MGI Phenotype PHENOTYPE: Homozygous knockout leads to changes in DNA methylation, resulting in an altered embryonic gene expression profile and embryonic sub-lethality (lower embryonic survival). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T C 5: 114,245,092 I2112T probably benign Het
Agtpbp1 C A 13: 59,450,318 probably benign Het
Ash1l T C 3: 88,983,316 M834T probably damaging Het
Aspg A G 12: 112,116,524 T213A possibly damaging Het
Chpf2 T C 5: 24,589,648 V272A possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ddah2 G T 17: 35,061,527 D215Y probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Fam46c T C 3: 100,473,000 T147A possibly damaging Het
Fbrsl1 T A 5: 110,374,519 M150L probably benign Het
Itga2 C T 13: 114,866,155 probably null Het
Jmjd1c T C 10: 67,239,236 probably benign Het
Krr1 T A 10: 111,975,657 H85Q probably benign Het
Krt83 C T 15: 101,491,433 R6Q probably benign Het
Krtap24-1 T C 16: 88,611,642 M199V probably benign Het
Krtap5-2 A T 7: 142,174,883 C353* probably null Het
Myo7a T G 7: 98,097,673 I178L possibly damaging Het
Myof G A 19: 37,910,960 T1043I probably damaging Het
Noc4l C T 5: 110,650,584 E247K probably damaging Het
Notch4 T C 17: 34,568,863 C437R probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Olfr1180 A T 2: 88,412,546 N37K probably damaging Het
Olfr859 A G 9: 19,808,632 I105V probably benign Het
Pank4 T C 4: 154,978,173 F584L probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Ranbp2 T A 10: 58,477,053 F1198L probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Unc13a A G 8: 71,654,986 I554T probably damaging Het
Zfc3h1 A G 10: 115,411,961 D1023G probably damaging Het
Zfp791 T A 8: 85,110,954 K94* probably null Het
Other mutations in Hmces
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02272:Hmces APN 6 87917855 unclassified probably null
IGL02330:Hmces APN 6 87914535 missense probably damaging 0.97
IGL02803:Hmces APN 6 87925729 missense probably damaging 0.96
IGL03222:Hmces APN 6 87925692 missense probably damaging 0.96
R1470:Hmces UTSW 6 87936139 missense probably benign 0.06
R1470:Hmces UTSW 6 87936139 missense probably benign 0.06
R1705:Hmces UTSW 6 87933301 missense probably damaging 0.99
R1711:Hmces UTSW 6 87921592 nonsense probably null
R2571:Hmces UTSW 6 87936220 missense possibly damaging 0.62
R3014:Hmces UTSW 6 87917841 missense probably benign 0.40
R5150:Hmces UTSW 6 87933235 splice site probably null
X0013:Hmces UTSW 6 87936120 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GGGACATGCTTCTTCCTTCACACTG -3'
(R):5'- AGCTGACATTGGGCCACCACATTC -3'

Sequencing Primer
(F):5'- ACACTGGTATTCAACCCTGC -3'
(R):5'- GGTTACAATTCCAGTCAACTGGTG -3'
Posted On2014-01-15