Incidental Mutation 'R1196:Krtap5-2'
ID101119
Institutional Source Beutler Lab
Gene Symbol Krtap5-2
Ensembl Gene ENSMUSG00000054759
Gene Namekeratin associated protein 5-2
Synonyms
MMRRC Submission 039268-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R1196 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location142174535-142176005 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 142174883 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 353 (C353*)
Ref Sequence ENSEMBL: ENSMUSP00000140784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067978] [ENSMUST00000190456]
Predicted Effect probably null
Transcript: ENSMUST00000067978
AA Change: C175*
SMART Domains Protein: ENSMUSP00000070557
Gene: ENSMUSG00000054759
AA Change: C175*

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 129 173 4.4e-10 PFAM
Pfam:Keratin_B2_2 144 188 1.8e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000190456
AA Change: C353*
SMART Domains Protein: ENSMUSP00000140784
Gene: ENSMUSG00000054759
AA Change: C353*

DomainStartEndE-ValueType
low complexity region 2 358 N/A INTRINSIC
Meta Mutation Damage Score 0.57 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 94.9%
  • 20x: 86.8%
Validation Efficiency 97% (38/39)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T C 5: 114,245,092 I2112T probably benign Het
Agtpbp1 C A 13: 59,450,318 probably benign Het
Ash1l T C 3: 88,983,316 M834T probably damaging Het
Aspg A G 12: 112,116,524 T213A possibly damaging Het
Chpf2 T C 5: 24,589,648 V272A possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ddah2 G T 17: 35,061,527 D215Y probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Fam46c T C 3: 100,473,000 T147A possibly damaging Het
Fbrsl1 T A 5: 110,374,519 M150L probably benign Het
Hmces T A 6: 87,936,182 D306E probably benign Het
Itga2 C T 13: 114,866,155 probably null Het
Jmjd1c T C 10: 67,239,236 probably benign Het
Krr1 T A 10: 111,975,657 H85Q probably benign Het
Krt83 C T 15: 101,491,433 R6Q probably benign Het
Krtap24-1 T C 16: 88,611,642 M199V probably benign Het
Myo7a T G 7: 98,097,673 I178L possibly damaging Het
Myof G A 19: 37,910,960 T1043I probably damaging Het
Noc4l C T 5: 110,650,584 E247K probably damaging Het
Notch4 T C 17: 34,568,863 C437R probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Olfr1180 A T 2: 88,412,546 N37K probably damaging Het
Olfr859 A G 9: 19,808,632 I105V probably benign Het
Pank4 T C 4: 154,978,173 F584L probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Ranbp2 T A 10: 58,477,053 F1198L probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Unc13a A G 8: 71,654,986 I554T probably damaging Het
Zfc3h1 A G 10: 115,411,961 D1023G probably damaging Het
Zfp791 T A 8: 85,110,954 K94* probably null Het
Other mutations in Krtap5-2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01958:Krtap5-2 APN 7 142175722 nonsense probably null
IGL02064:Krtap5-2 APN 7 142175731 missense unknown
IGL03214:Krtap5-2 APN 7 142175014 missense unknown
IGL03326:Krtap5-2 APN 7 142175363 nonsense probably null
R2327:Krtap5-2 UTSW 7 142175011 missense unknown
R5166:Krtap5-2 UTSW 7 142174984 missense unknown
R5723:Krtap5-2 UTSW 7 142175005 missense unknown
R6356:Krtap5-2 UTSW 7 142175382 intron probably benign
R6364:Krtap5-2 UTSW 7 142175063 nonsense probably null
R6593:Krtap5-2 UTSW 7 142174960 missense unknown
R7193:Krtap5-2 UTSW 7 142175243 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GGAGCTGTGACTCCTCTGCACATT -3'
(R):5'- TCCTGTGGTTGCTGCCAGTCCA -3'

Sequencing Primer
(F):5'- TGGCATCCATCTATTAGGGAAG -3'
(R):5'- TGTTGTTGCCAATCCAGCTG -3'
Posted On2014-01-15