Incidental Mutation 'R1196:Zfc3h1'
ID 101135
Institutional Source Beutler Lab
Gene Symbol Zfc3h1
Ensembl Gene ENSMUSG00000034163
Gene Name zinc finger, C3H1-type containing
Synonyms Ccdc131, Psrc2
MMRRC Submission 039268-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.943) question?
Stock # R1196 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 115220864-115268677 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 115247866 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1023 (D1023G)
Ref Sequence ENSEMBL: ENSMUSP00000044069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036044]
AlphaFold B2RT41
Predicted Effect probably damaging
Transcript: ENSMUST00000036044
AA Change: D1023G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000044069
Gene: ENSMUSG00000034163
AA Change: D1023G

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 29 90 N/A INTRINSIC
low complexity region 120 132 N/A INTRINSIC
low complexity region 143 214 N/A INTRINSIC
coiled coil region 361 393 N/A INTRINSIC
low complexity region 399 432 N/A INTRINSIC
coiled coil region 436 491 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 564 583 N/A INTRINSIC
low complexity region 595 619 N/A INTRINSIC
low complexity region 623 636 N/A INTRINSIC
low complexity region 716 729 N/A INTRINSIC
low complexity region 752 763 N/A INTRINSIC
coiled coil region 826 889 N/A INTRINSIC
coiled coil region 968 1000 N/A INTRINSIC
low complexity region 1001 1015 N/A INTRINSIC
Pfam:zf-C3H1 1187 1208 1.3e-11 PFAM
HAT 1384 1416 1.11e0 SMART
HAT 1418 1449 4.35e2 SMART
Blast:HAT 1495 1538 2e-9 BLAST
HAT 1653 1685 3.31e1 SMART
HAT 1762 1797 7.03e1 SMART
HAT 1922 1954 1.29e-1 SMART
low complexity region 1975 1992 N/A INTRINSIC
Meta Mutation Damage Score 0.2109 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 94.9%
  • 20x: 86.8%
Validation Efficiency 97% (38/39)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T C 5: 114,383,153 (GRCm39) I2112T probably benign Het
Agtpbp1 C A 13: 59,598,132 (GRCm39) probably benign Het
Ash1l T C 3: 88,890,623 (GRCm39) M834T probably damaging Het
Aspg A G 12: 112,082,958 (GRCm39) T213A possibly damaging Het
Chpf2 T C 5: 24,794,646 (GRCm39) V272A possibly damaging Het
D6Ertd527e C G 6: 87,088,506 (GRCm39) T223S unknown Het
Ddah2 G T 17: 35,280,503 (GRCm39) D215Y probably damaging Het
Dna2 C T 10: 62,784,966 (GRCm39) R28W probably benign Het
Fbrsl1 T A 5: 110,522,385 (GRCm39) M150L probably benign Het
Hmces T A 6: 87,913,164 (GRCm39) D306E probably benign Het
Itga2 C T 13: 115,002,691 (GRCm39) probably null Het
Jmjd1c T C 10: 67,075,015 (GRCm39) probably benign Het
Krr1 T A 10: 111,811,562 (GRCm39) H85Q probably benign Het
Krt87 C T 15: 101,389,314 (GRCm39) R6Q probably benign Het
Krtap24-1 T C 16: 88,408,530 (GRCm39) M199V probably benign Het
Krtap5-2 A T 7: 141,728,620 (GRCm39) C353* probably null Het
Myo7a T G 7: 97,746,880 (GRCm39) I178L possibly damaging Het
Myof G A 19: 37,899,408 (GRCm39) T1043I probably damaging Het
Noc4l C T 5: 110,798,450 (GRCm39) E247K probably damaging Het
Notch4 T C 17: 34,787,837 (GRCm39) C437R probably damaging Het
Nrbp1 T A 5: 31,403,157 (GRCm39) I210N probably damaging Het
Or4p19 A T 2: 88,242,890 (GRCm39) N37K probably damaging Het
Or7e168 A G 9: 19,719,928 (GRCm39) I105V probably benign Het
Pank4 T C 4: 155,062,630 (GRCm39) F584L probably damaging Het
Prl2c2 G C 13: 13,176,786 (GRCm39) T47R probably damaging Het
Ranbp2 T A 10: 58,312,875 (GRCm39) F1198L probably damaging Het
Sf3b1 C G 1: 55,058,554 (GRCm39) E12Q possibly damaging Het
Tent5c T C 3: 100,380,316 (GRCm39) T147A possibly damaging Het
Ttc28 G A 5: 111,373,543 (GRCm39) S962N probably damaging Het
Unc13a A G 8: 72,107,630 (GRCm39) I554T probably damaging Het
Zfp791 T A 8: 85,837,583 (GRCm39) K94* probably null Het
Other mutations in Zfc3h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00698:Zfc3h1 APN 10 115,255,737 (GRCm39) missense possibly damaging 0.92
IGL00793:Zfc3h1 APN 10 115,252,779 (GRCm39) missense probably benign 0.00
IGL01349:Zfc3h1 APN 10 115,259,353 (GRCm39) missense probably damaging 1.00
IGL01431:Zfc3h1 APN 10 115,259,128 (GRCm39) missense possibly damaging 0.49
IGL02273:Zfc3h1 APN 10 115,263,004 (GRCm39) missense probably benign
IGL02382:Zfc3h1 APN 10 115,252,781 (GRCm39) nonsense probably null
IGL02397:Zfc3h1 APN 10 115,243,890 (GRCm39) missense probably damaging 1.00
IGL02657:Zfc3h1 APN 10 115,247,859 (GRCm39) missense possibly damaging 0.48
IGL02826:Zfc3h1 APN 10 115,236,809 (GRCm39) missense probably benign 0.42
Gnatcatcher UTSW 10 115,236,647 (GRCm39) missense probably benign 0.39
hutton UTSW 10 115,251,153 (GRCm39) missense probably damaging 0.96
passerine UTSW 10 115,249,916 (GRCm39) missense possibly damaging 0.56
R0178_Zfc3h1_655 UTSW 10 115,242,630 (GRCm39) splice site probably benign
vireo UTSW 10 115,255,806 (GRCm39) missense probably benign 0.01
warbler UTSW 10 115,242,388 (GRCm39) missense probably damaging 1.00
PIT4260001:Zfc3h1 UTSW 10 115,226,794 (GRCm39) missense probably damaging 0.99
PIT4354001:Zfc3h1 UTSW 10 115,262,944 (GRCm39) nonsense probably null
R0062:Zfc3h1 UTSW 10 115,252,658 (GRCm39) missense probably benign 0.00
R0062:Zfc3h1 UTSW 10 115,252,658 (GRCm39) missense probably benign 0.00
R0067:Zfc3h1 UTSW 10 115,259,379 (GRCm39) missense possibly damaging 0.88
R0067:Zfc3h1 UTSW 10 115,259,379 (GRCm39) missense possibly damaging 0.88
R0104:Zfc3h1 UTSW 10 115,251,192 (GRCm39) missense possibly damaging 0.66
R0178:Zfc3h1 UTSW 10 115,242,630 (GRCm39) splice site probably benign
R0355:Zfc3h1 UTSW 10 115,245,018 (GRCm39) missense possibly damaging 0.80
R0619:Zfc3h1 UTSW 10 115,256,715 (GRCm39) missense possibly damaging 0.92
R0731:Zfc3h1 UTSW 10 115,246,537 (GRCm39) missense probably benign 0.00
R0828:Zfc3h1 UTSW 10 115,237,612 (GRCm39) missense possibly damaging 0.68
R0866:Zfc3h1 UTSW 10 115,263,621 (GRCm39) missense probably benign 0.00
R1455:Zfc3h1 UTSW 10 115,248,013 (GRCm39) missense probably benign 0.11
R1515:Zfc3h1 UTSW 10 115,252,647 (GRCm39) missense probably benign 0.29
R1617:Zfc3h1 UTSW 10 115,226,827 (GRCm39) missense probably benign 0.01
R1640:Zfc3h1 UTSW 10 115,242,806 (GRCm39) splice site probably null
R1959:Zfc3h1 UTSW 10 115,259,158 (GRCm39) missense probably benign 0.34
R2039:Zfc3h1 UTSW 10 115,242,388 (GRCm39) missense probably damaging 1.00
R3430:Zfc3h1 UTSW 10 115,246,428 (GRCm39) splice site probably benign
R3691:Zfc3h1 UTSW 10 115,256,595 (GRCm39) missense probably benign
R3909:Zfc3h1 UTSW 10 115,255,806 (GRCm39) missense probably benign 0.01
R4235:Zfc3h1 UTSW 10 115,254,704 (GRCm39) missense probably benign 0.32
R4684:Zfc3h1 UTSW 10 115,259,290 (GRCm39) missense probably benign 0.03
R4816:Zfc3h1 UTSW 10 115,251,599 (GRCm39) missense probably benign 0.16
R4881:Zfc3h1 UTSW 10 115,236,647 (GRCm39) missense probably benign 0.39
R4883:Zfc3h1 UTSW 10 115,246,547 (GRCm39) missense probably damaging 1.00
R5038:Zfc3h1 UTSW 10 115,240,116 (GRCm39) missense probably benign 0.16
R5068:Zfc3h1 UTSW 10 115,254,688 (GRCm39) nonsense probably null
R5069:Zfc3h1 UTSW 10 115,254,688 (GRCm39) nonsense probably null
R5070:Zfc3h1 UTSW 10 115,254,688 (GRCm39) nonsense probably null
R5155:Zfc3h1 UTSW 10 115,248,026 (GRCm39) missense possibly damaging 0.64
R5190:Zfc3h1 UTSW 10 115,254,597 (GRCm39) missense probably damaging 1.00
R5499:Zfc3h1 UTSW 10 115,246,598 (GRCm39) missense probably damaging 1.00
R5932:Zfc3h1 UTSW 10 115,236,815 (GRCm39) missense probably benign 0.44
R5935:Zfc3h1 UTSW 10 115,267,262 (GRCm39) intron probably benign
R6165:Zfc3h1 UTSW 10 115,256,574 (GRCm39) missense probably benign 0.30
R6182:Zfc3h1 UTSW 10 115,226,764 (GRCm39) missense probably benign 0.00
R6262:Zfc3h1 UTSW 10 115,249,881 (GRCm39) missense probably damaging 1.00
R6382:Zfc3h1 UTSW 10 115,243,813 (GRCm39) missense probably benign 0.06
R6392:Zfc3h1 UTSW 10 115,237,653 (GRCm39) missense probably damaging 1.00
R6539:Zfc3h1 UTSW 10 115,247,907 (GRCm39) missense probably benign 0.26
R6723:Zfc3h1 UTSW 10 115,256,638 (GRCm39) missense probably benign 0.34
R7339:Zfc3h1 UTSW 10 115,239,205 (GRCm39) missense probably damaging 1.00
R7381:Zfc3h1 UTSW 10 115,260,535 (GRCm39) missense probably benign
R7404:Zfc3h1 UTSW 10 115,251,153 (GRCm39) missense probably damaging 0.96
R7667:Zfc3h1 UTSW 10 115,246,606 (GRCm39) nonsense probably null
R7748:Zfc3h1 UTSW 10 115,236,720 (GRCm39) missense probably benign 0.27
R7910:Zfc3h1 UTSW 10 115,256,588 (GRCm39) nonsense probably null
R7914:Zfc3h1 UTSW 10 115,239,062 (GRCm39) splice site probably null
R8023:Zfc3h1 UTSW 10 115,256,553 (GRCm39) missense probably damaging 1.00
R8169:Zfc3h1 UTSW 10 115,254,616 (GRCm39) missense probably damaging 0.98
R8358:Zfc3h1 UTSW 10 115,240,198 (GRCm39) missense probably benign 0.13
R8746:Zfc3h1 UTSW 10 115,243,885 (GRCm39) missense probably damaging 1.00
R8803:Zfc3h1 UTSW 10 115,247,800 (GRCm39) missense probably benign
R8905:Zfc3h1 UTSW 10 115,259,383 (GRCm39) missense probably benign 0.05
R9045:Zfc3h1 UTSW 10 115,263,319 (GRCm39) missense possibly damaging 0.49
R9164:Zfc3h1 UTSW 10 115,259,374 (GRCm39) missense probably benign 0.17
R9211:Zfc3h1 UTSW 10 115,248,328 (GRCm39) missense possibly damaging 0.83
R9216:Zfc3h1 UTSW 10 115,221,528 (GRCm39) missense unknown
R9305:Zfc3h1 UTSW 10 115,255,771 (GRCm39) missense probably benign 0.19
R9372:Zfc3h1 UTSW 10 115,221,223 (GRCm39) missense unknown
R9394:Zfc3h1 UTSW 10 115,254,600 (GRCm39) missense probably damaging 1.00
R9414:Zfc3h1 UTSW 10 115,249,916 (GRCm39) missense possibly damaging 0.56
R9538:Zfc3h1 UTSW 10 115,221,197 (GRCm39) missense unknown
R9623:Zfc3h1 UTSW 10 115,259,362 (GRCm39) missense possibly damaging 0.94
R9633:Zfc3h1 UTSW 10 115,247,852 (GRCm39) missense probably damaging 1.00
R9747:Zfc3h1 UTSW 10 115,244,821 (GRCm39) missense possibly damaging 0.58
Z1176:Zfc3h1 UTSW 10 115,243,907 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGTCCAAGGAAGCATTCAGCAG -3'
(R):5'- AGCCAGGGTAACTCTGAAATGCAC -3'

Sequencing Primer
(F):5'- TTAAAAGAAGCCCGAGCCCTC -3'
(R):5'- GGTCTAAATGGACATGGCTTCAC -3'
Posted On 2014-01-15