Incidental Mutation 'R1196:Aspg'
ID101137
Institutional Source Beutler Lab
Gene Symbol Aspg
Ensembl Gene ENSMUSG00000037686
Gene Nameasparaginase
Synonyms
MMRRC Submission 039268-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R1196 (G1)
Quality Score217
Status Validated
Chromosome12
Chromosomal Location112106679-112127559 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112116524 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 213 (T213A)
Ref Sequence ENSEMBL: ENSMUSP00000078369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079400] [ENSMUST00000223184]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079400
AA Change: T213A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078369
Gene: ENSMUSG00000037686
AA Change: T213A

DomainStartEndE-ValueType
Asparaginase 10 348 2.67e-111 SMART
ANK 396 426 4.05e2 SMART
ANK 430 459 4.46e-7 SMART
ANK 463 494 1.1e2 SMART
ANK 530 559 4.73e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221091
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222645
Predicted Effect probably benign
Transcript: ENSMUST00000222970
Predicted Effect probably benign
Transcript: ENSMUST00000223184
Predicted Effect unknown
Transcript: ENSMUST00000223412
AA Change: T178A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223457
Meta Mutation Damage Score 0.09 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 94.9%
  • 20x: 86.8%
Validation Efficiency 97% (38/39)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T C 5: 114,245,092 I2112T probably benign Het
Agtpbp1 C A 13: 59,450,318 probably benign Het
Ash1l T C 3: 88,983,316 M834T probably damaging Het
Chpf2 T C 5: 24,589,648 V272A possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ddah2 G T 17: 35,061,527 D215Y probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Fam46c T C 3: 100,473,000 T147A possibly damaging Het
Fbrsl1 T A 5: 110,374,519 M150L probably benign Het
Hmces T A 6: 87,936,182 D306E probably benign Het
Itga2 C T 13: 114,866,155 probably null Het
Jmjd1c T C 10: 67,239,236 probably benign Het
Krr1 T A 10: 111,975,657 H85Q probably benign Het
Krt83 C T 15: 101,491,433 R6Q probably benign Het
Krtap24-1 T C 16: 88,611,642 M199V probably benign Het
Krtap5-2 A T 7: 142,174,883 C353* probably null Het
Myo7a T G 7: 98,097,673 I178L possibly damaging Het
Myof G A 19: 37,910,960 T1043I probably damaging Het
Noc4l C T 5: 110,650,584 E247K probably damaging Het
Notch4 T C 17: 34,568,863 C437R probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Olfr1180 A T 2: 88,412,546 N37K probably damaging Het
Olfr859 A G 9: 19,808,632 I105V probably benign Het
Pank4 T C 4: 154,978,173 F584L probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Ranbp2 T A 10: 58,477,053 F1198L probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Unc13a A G 8: 71,654,986 I554T probably damaging Het
Zfc3h1 A G 10: 115,411,961 D1023G probably damaging Het
Zfp791 T A 8: 85,110,954 K94* probably null Het
Other mutations in Aspg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Aspg APN 12 112122953 missense probably benign
IGL02199:Aspg APN 12 112120992 missense probably benign 0.39
R0704:Aspg UTSW 12 112114472 missense probably damaging 1.00
R0730:Aspg UTSW 12 112112259 nonsense probably null
R1270:Aspg UTSW 12 112116447 missense probably damaging 1.00
R1466:Aspg UTSW 12 112121852 missense probably benign 0.20
R1466:Aspg UTSW 12 112121852 missense probably benign 0.20
R1592:Aspg UTSW 12 112119972 missense probably benign 0.17
R1826:Aspg UTSW 12 112123418 missense probably damaging 0.99
R1859:Aspg UTSW 12 112121172 missense possibly damaging 0.86
R2124:Aspg UTSW 12 112121174 missense probably benign 0.15
R2154:Aspg UTSW 12 112120974 missense probably benign 0.01
R2190:Aspg UTSW 12 112124888 missense probably damaging 0.96
R2221:Aspg UTSW 12 112114434 missense probably damaging 1.00
R2223:Aspg UTSW 12 112114434 missense probably damaging 1.00
R3907:Aspg UTSW 12 112112259 nonsense probably null
R4234:Aspg UTSW 12 112123316 nonsense probably null
R4258:Aspg UTSW 12 112121253 missense probably benign 0.00
R4270:Aspg UTSW 12 112121195 missense probably damaging 1.00
R4271:Aspg UTSW 12 112121195 missense probably damaging 1.00
R5386:Aspg UTSW 12 112123032 missense probably benign 0.01
R5431:Aspg UTSW 12 112123412 missense probably benign 0.13
R5458:Aspg UTSW 12 112120002 missense probably damaging 0.99
R5941:Aspg UTSW 12 112113085 missense probably benign 0.02
R6003:Aspg UTSW 12 112113042 missense probably damaging 1.00
R6057:Aspg UTSW 12 112120998 missense probably damaging 0.96
R6928:Aspg UTSW 12 112126689 missense possibly damaging 0.52
R6979:Aspg UTSW 12 112120944 missense possibly damaging 0.77
R6998:Aspg UTSW 12 112112194 missense probably damaging 1.00
R7054:Aspg UTSW 12 112126390 missense probably damaging 0.98
R7060:Aspg UTSW 12 112122953 missense probably benign
R7124:Aspg UTSW 12 112122983 missense probably damaging 0.99
R7137:Aspg UTSW 12 112112198 missense possibly damaging 0.92
R7439:Aspg UTSW 12 112124821 missense possibly damaging 0.90
R7441:Aspg UTSW 12 112124821 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGCAGTCATTTGTGTGTTCAATGCC -3'
(R):5'- CTGGGATGCCTAAGAGCCATGTTAC -3'

Sequencing Primer
(F):5'- TGTGTTCAATGCCAGGCTC -3'
(R):5'- TGCCTAAGAGCCATGTTACACTAC -3'
Posted On2014-01-15