Incidental Mutation 'R1196:Prl2c2'
ID101139
Institutional Source Beutler Lab
Gene Symbol Prl2c2
Ensembl Gene ENSMUSG00000079092
Gene Nameprolactin family 2, subfamily c, member 2
SynonymsPlf, Plf1, MRP-1, PLF-1
MMRRC Submission 039268-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R1196 (G1)
Quality Score177
Status Validated
Chromosome13
Chromosomal Location12996125-13005383 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 13002201 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Arginine at position 47 (T47R)
Ref Sequence ENSEMBL: ENSMUSP00000152538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110594] [ENSMUST00000220558] [ENSMUST00000221612] [ENSMUST00000221627]
Predicted Effect probably damaging
Transcript: ENSMUST00000110594
AA Change: T47R

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106224
Gene: ENSMUSG00000079092
AA Change: T47R

DomainStartEndE-ValueType
Pfam:Hormone_1 16 224 9.2e-76 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000220558
AA Change: T45R

PolyPhen 2 Score 0.593 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably damaging
Transcript: ENSMUST00000221612
AA Change: T47R

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000221627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223124
Meta Mutation Damage Score 0.0652 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 94.9%
  • 20x: 86.8%
Validation Efficiency 97% (38/39)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T C 5: 114,245,092 I2112T probably benign Het
Agtpbp1 C A 13: 59,450,318 probably benign Het
Ash1l T C 3: 88,983,316 M834T probably damaging Het
Aspg A G 12: 112,116,524 T213A possibly damaging Het
Chpf2 T C 5: 24,589,648 V272A possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ddah2 G T 17: 35,061,527 D215Y probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Fam46c T C 3: 100,473,000 T147A possibly damaging Het
Fbrsl1 T A 5: 110,374,519 M150L probably benign Het
Hmces T A 6: 87,936,182 D306E probably benign Het
Itga2 C T 13: 114,866,155 probably null Het
Jmjd1c T C 10: 67,239,236 probably benign Het
Krr1 T A 10: 111,975,657 H85Q probably benign Het
Krt83 C T 15: 101,491,433 R6Q probably benign Het
Krtap24-1 T C 16: 88,611,642 M199V probably benign Het
Krtap5-2 A T 7: 142,174,883 C353* probably null Het
Myo7a T G 7: 98,097,673 I178L possibly damaging Het
Myof G A 19: 37,910,960 T1043I probably damaging Het
Noc4l C T 5: 110,650,584 E247K probably damaging Het
Notch4 T C 17: 34,568,863 C437R probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Olfr1180 A T 2: 88,412,546 N37K probably damaging Het
Olfr859 A G 9: 19,808,632 I105V probably benign Het
Pank4 T C 4: 154,978,173 F584L probably damaging Het
Ranbp2 T A 10: 58,477,053 F1198L probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Unc13a A G 8: 71,654,986 I554T probably damaging Het
Zfc3h1 A G 10: 115,411,961 D1023G probably damaging Het
Zfp791 T A 8: 85,110,954 K94* probably null Het
Other mutations in Prl2c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Prl2c2 APN 13 13002243 missense probably damaging 1.00
R0991:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R0993:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1139:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1250:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1319:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1321:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1325:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1341:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1382:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1415:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1494:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1878:Prl2c2 UTSW 13 13005326 start codon destroyed probably damaging 0.99
R1950:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1983:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1999:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R3704:Prl2c2 UTSW 13 13002225 missense probably damaging 0.99
R4972:Prl2c2 UTSW 13 13002170 missense possibly damaging 0.74
R6170:Prl2c2 UTSW 13 13002172 missense probably damaging 0.99
R6766:Prl2c2 UTSW 13 13002128 splice site probably null
X0065:Prl2c2 UTSW 13 13002175 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGCTTTCTGCTTTAGGCTATGCACTA -3'
(R):5'- TCAGCACCCTGCCTTGAATCAAAT -3'

Sequencing Primer
(F):5'- CTATATCAACCATTGTGTTGGAGGC -3'
(R):5'- caaaacaaccaaccaaccaac -3'
Posted On2014-01-15