Incidental Mutation 'R1196:Ddah2'
ID101150
Institutional Source Beutler Lab
Gene Symbol Ddah2
Ensembl Gene ENSMUSG00000007039
Gene Namedimethylarginine dimethylaminohydrolase 2
SynonymsClone 7u, G6a, NG30, Ddah
MMRRC Submission 039268-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R1196 (G1)
Quality Score224
Status Validated
Chromosome17
Chromosomal Location35059035-35062095 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 35061527 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 215 (D215Y)
Ref Sequence ENSEMBL: ENSMUSP00000134072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007255] [ENSMUST00000007257] [ENSMUST00000097337] [ENSMUST00000173207] [ENSMUST00000173520] [ENSMUST00000174190] [ENSMUST00000174493]
Predicted Effect probably damaging
Transcript: ENSMUST00000007255
AA Change: D215Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000007255
Gene: ENSMUSG00000007039
AA Change: D215Y

DomainStartEndE-ValueType
PDB:2JAJ|B 1 282 1e-77 PDB
SCOP:d1h70a_ 13 277 1e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000007257
SMART Domains Protein: ENSMUSP00000007257
Gene: ENSMUSG00000007041

DomainStartEndE-ValueType
Pfam:GST_N_3 21 92 4.8e-11 PFAM
Pfam:GST_N_2 23 87 3.3e-10 PFAM
Pfam:GST_C_2 123 212 3.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097337
SMART Domains Protein: ENSMUSP00000094950
Gene: ENSMUSG00000073414

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 20 121 3.27e0 SMART
low complexity region 145 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173207
SMART Domains Protein: ENSMUSP00000134194
Gene: ENSMUSG00000092586

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
Blast:LU 48 136 3e-57 BLAST
low complexity region 139 151 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173520
SMART Domains Protein: ENSMUSP00000134595
Gene: ENSMUSG00000007039

DomainStartEndE-ValueType
Pfam:Amidinotransf 28 157 1.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173562
Predicted Effect probably benign
Transcript: ENSMUST00000174190
SMART Domains Protein: ENSMUSP00000133377
Gene: ENSMUSG00000073414

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 20 121 3.27e0 SMART
low complexity region 145 160 N/A INTRINSIC
low complexity region 168 180 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174493
AA Change: D215Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134072
Gene: ENSMUSG00000007039
AA Change: D215Y

DomainStartEndE-ValueType
Pfam:Amidinotransf 30 232 5e-27 PFAM
Meta Mutation Damage Score 0.472 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 94.9%
  • 20x: 86.8%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dimethylarginine dimethylaminohydrolase. The encoded enzyme functions in nitric oxide generation by regulating the cellular concentrations of methylarginines, which in turn inhibit nitric oxide synthase activity. The protein may be localized to the mitochondria. Alternative splicing resulting in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice exhibit normal embryonic survival. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T C 5: 114,245,092 I2112T probably benign Het
Agtpbp1 C A 13: 59,450,318 probably benign Het
Ash1l T C 3: 88,983,316 M834T probably damaging Het
Aspg A G 12: 112,116,524 T213A possibly damaging Het
Chpf2 T C 5: 24,589,648 V272A possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Fam46c T C 3: 100,473,000 T147A possibly damaging Het
Fbrsl1 T A 5: 110,374,519 M150L probably benign Het
Hmces T A 6: 87,936,182 D306E probably benign Het
Itga2 C T 13: 114,866,155 probably null Het
Jmjd1c T C 10: 67,239,236 probably benign Het
Krr1 T A 10: 111,975,657 H85Q probably benign Het
Krt83 C T 15: 101,491,433 R6Q probably benign Het
Krtap24-1 T C 16: 88,611,642 M199V probably benign Het
Krtap5-2 A T 7: 142,174,883 C353* probably null Het
Myo7a T G 7: 98,097,673 I178L possibly damaging Het
Myof G A 19: 37,910,960 T1043I probably damaging Het
Noc4l C T 5: 110,650,584 E247K probably damaging Het
Notch4 T C 17: 34,568,863 C437R probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Olfr1180 A T 2: 88,412,546 N37K probably damaging Het
Olfr859 A G 9: 19,808,632 I105V probably benign Het
Pank4 T C 4: 154,978,173 F584L probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Ranbp2 T A 10: 58,477,053 F1198L probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Unc13a A G 8: 71,654,986 I554T probably damaging Het
Zfc3h1 A G 10: 115,411,961 D1023G probably damaging Het
Zfp791 T A 8: 85,110,954 K94* probably null Het
Other mutations in Ddah2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00548:Ddah2 APN 17 35060631 missense possibly damaging 0.89
IGL02704:Ddah2 APN 17 35061007 missense possibly damaging 0.94
IGL02949:Ddah2 APN 17 35061800 missense probably damaging 0.97
R1875:Ddah2 UTSW 17 35060845 missense probably damaging 1.00
R2018:Ddah2 UTSW 17 35060426 missense possibly damaging 0.57
R2225:Ddah2 UTSW 17 35060211 missense probably damaging 1.00
R2245:Ddah2 UTSW 17 35061585 missense probably damaging 1.00
R5826:Ddah2 UTSW 17 35060688 missense probably damaging 1.00
X0018:Ddah2 UTSW 17 35060667 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GCTAAAGTGCCTGAGACGACTGTG -3'
(R):5'- AGGGTGACATCAGAGAGCTTCTGC -3'

Sequencing Primer
(F):5'- AGACGACTGTGTCTGTCAC -3'
(R):5'- GGACCCCAAGGATGTTTTGATAAC -3'
Posted On2014-01-15