Incidental Mutation 'R1199:Kel'
ID101200
Institutional Source Beutler Lab
Gene Symbol Kel
Ensembl Gene ENSMUSG00000029866
Gene NameKell blood group
SynonymsCD238
MMRRC Submission 039269-MU
Accession Numbers

Genbank: NM_032540; MGI: 1346053

Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R1199 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location41686330-41704339 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 41688591 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 532 (V532I)
Ref Sequence ENSEMBL: ENSMUSP00000031899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031899] [ENSMUST00000031900] [ENSMUST00000194597]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031899
AA Change: V532I

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031899
Gene: ENSMUSG00000029866
AA Change: V532I

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
Pfam:Peptidase_M13_N 81 463 1.5e-68 PFAM
Pfam:Peptidase_M13 521 712 2.1e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031900
SMART Domains Protein: ENSMUSP00000031900
Gene: ENSMUSG00000029867

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:DUF4717 37 107 7.8e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153760
Predicted Effect possibly damaging
Transcript: ENSMUST00000192118
AA Change: V214I

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192406
Predicted Effect probably benign
Transcript: ENSMUST00000194597
SMART Domains Protein: ENSMUSP00000142058
Gene: ENSMUSG00000029866

DomainStartEndE-ValueType
Pfam:Peptidase_M13 16 68 3.6e-10 PFAM
Meta Mutation Damage Score 0.086 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II transmembrane glycoprotein that is the highly polymorphic Kell blood group antigen. The Kell glycoprotein links via a single disulfide bond to the XK membrane protein that carries the Kx antigen. The encoded protein contains sequence and structural similarity to members of the neprilysin (M13) family of zinc endopeptidases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased heart rate, altered hematological parameters and ECG waveform features, decreased erythrocyte Mg2+ and K+ ion content, mild motor deficits, and giant axon changes with varying degrees of paranodal demyelination in the spinal cord and sciatic nerve. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A T 9: 108,393,477 H80L possibly damaging Het
A1bg A T 15: 60,919,635 probably null Het
Aco2 C T 15: 81,895,193 S33L probably damaging Het
Agrn T A 4: 156,172,299 Y1283F probably benign Het
Akap6 T C 12: 52,796,190 V107A probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Btnl9 A T 11: 49,180,747 V83E probably damaging Het
Camk2a T A 18: 60,952,324 C131* probably null Het
Ccdc14 C T 16: 34,723,828 T852M probably damaging Het
Cntn4 T C 6: 106,353,597 probably benign Het
Cp T G 3: 19,977,152 S585R probably damaging Het
Cpt1b G A 15: 89,419,010 A614V probably benign Het
Crygn T C 5: 24,751,148 Y153C probably damaging Het
Dennd1a A T 2: 37,961,716 D53E probably damaging Het
Deptor T C 15: 55,252,010 C357R probably benign Het
Dnajc28 C A 16: 91,618,642 probably benign Het
Eml6 G A 11: 29,755,044 A1500V possibly damaging Het
Fgd5 T A 6: 91,986,978 L64Q possibly damaging Het
Fgfbp1 A G 5: 43,979,597 Y118H probably damaging Het
Ftcd G A 10: 76,579,819 R135H probably damaging Het
Gm5174 A T 10: 86,657,325 noncoding transcript Het
Gpr37l1 A T 1: 135,166,972 L178Q probably damaging Het
Gtf2ird1 A G 5: 134,411,064 V104A possibly damaging Het
Irs1 T A 1: 82,289,626 S290C probably damaging Het
Kif1c A G 11: 70,708,601 E442G possibly damaging Het
Klhdc10 T A 6: 30,449,494 V185D probably damaging Het
Lpp C T 16: 24,681,860 R141C probably damaging Het
Olfr1025-ps1 A G 2: 85,918,035 I37V probably benign Het
Olfr68 A T 7: 103,777,985 M120K probably damaging Het
Pcnx2 G T 8: 125,887,314 P466H possibly damaging Het
Pcsk1 A T 13: 75,096,413 probably benign Het
Pkd2l2 T C 18: 34,438,216 probably null Het
Pomt1 A G 2: 32,250,492 N454S probably benign Het
Samhd1 A T 2: 157,109,461 I452N probably damaging Het
Sez6 A G 11: 77,953,885 Q178R probably benign Het
Slc25a44 A G 3: 88,420,986 V66A probably damaging Het
Slc46a2 T C 4: 59,914,189 T245A probably benign Het
Slc4a4 G A 5: 89,215,794 probably null Het
Spata6 T A 4: 111,799,145 C329S possibly damaging Het
Srrm2 A T 17: 23,817,751 probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Svil T A 18: 5,059,217 probably benign Het
Tenm3 G T 8: 48,235,582 S2323R probably damaging Het
Tsc1 G A 2: 28,665,626 R245Q probably damaging Het
Ttn A G 2: 76,908,756 V3813A probably benign Het
Ttn G A 2: 76,950,044 T1121M possibly damaging Het
Ush2a G A 1: 188,759,795 V3094I probably benign Het
Vcan A G 13: 89,679,794 probably null Het
Vmn1r189 A T 13: 22,102,658 L3Q probably damaging Het
Vmn1r60 A C 7: 5,544,972 V43G probably damaging Het
Vmn2r110 A G 17: 20,583,263 I350T probably benign Het
Vmn2r86 T A 10: 130,448,574 probably benign Het
Xrn1 A G 9: 95,981,761 probably benign Het
Zfp251 C T 15: 76,854,236 R219Q possibly damaging Het
Other mutations in Kel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Kel APN 6 41688575 missense probably damaging 1.00
IGL00792:Kel APN 6 41702012 missense probably damaging 1.00
IGL00972:Kel APN 6 41688066 missense possibly damaging 0.62
IGL01121:Kel APN 6 41702409 missense probably benign 0.00
IGL01286:Kel APN 6 41688117 splice site probably null
IGL01461:Kel APN 6 41701911 critical splice donor site probably null
IGL01836:Kel APN 6 41697438 missense possibly damaging 0.50
IGL02037:Kel APN 6 41697474 missense probably benign 0.01
IGL02103:Kel APN 6 41702389 missense probably benign 0.18
IGL02604:Kel APN 6 41687582 missense probably damaging 0.98
IGL03102:Kel APN 6 41702983 missense probably benign 0.00
IGL03274:Kel APN 6 41687995 unclassified probably null
IGL03355:Kel APN 6 41698887 critical splice donor site probably null
A4554:Kel UTSW 6 41697419 missense possibly damaging 0.95
R0121:Kel UTSW 6 41702064 unclassified probably benign
R0153:Kel UTSW 6 41701943 missense probably benign 0.08
R0535:Kel UTSW 6 41690838 missense probably null 0.21
R0658:Kel UTSW 6 41703031 missense probably damaging 1.00
R1005:Kel UTSW 6 41688617 missense probably damaging 1.00
R1272:Kel UTSW 6 41703470 missense probably benign 0.00
R1531:Kel UTSW 6 41688626 missense probably damaging 0.99
R1880:Kel UTSW 6 41687545 missense possibly damaging 0.95
R2102:Kel UTSW 6 41686484 missense possibly damaging 0.86
R2118:Kel UTSW 6 41689300 missense probably benign
R2571:Kel UTSW 6 41688067 missense possibly damaging 0.62
R4209:Kel UTSW 6 41698425 nonsense probably null
R4210:Kel UTSW 6 41698425 nonsense probably null
R4260:Kel UTSW 6 41686423 utr 3 prime probably benign
R4382:Kel UTSW 6 41698400 missense probably benign 0.13
R5023:Kel UTSW 6 41688111 missense probably damaging 1.00
R5033:Kel UTSW 6 41699055 missense probably damaging 1.00
R5239:Kel UTSW 6 41688114 nonsense probably null
R5431:Kel UTSW 6 41698420 missense probably benign 0.23
R5742:Kel UTSW 6 41699027 missense probably damaging 1.00
R5745:Kel UTSW 6 41699027 missense probably damaging 1.00
R5746:Kel UTSW 6 41699027 missense probably damaging 1.00
R5978:Kel UTSW 6 41688045 missense probably benign 0.00
R6023:Kel UTSW 6 41697475 missense probably benign
R6109:Kel UTSW 6 41688862 missense probably benign 0.06
R6125:Kel UTSW 6 41690786 missense probably damaging 1.00
R6319:Kel UTSW 6 41702447 missense probably benign 0.05
R6368:Kel UTSW 6 41688851 nonsense probably null
R6864:Kel UTSW 6 41703760 critical splice donor site probably null
R6956:Kel UTSW 6 41687973 missense probably damaging 1.00
X0028:Kel UTSW 6 41698351 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCGCCAAAGTTCACAGCTCTAAAG -3'
(R):5'- TGCATCAAATGACCTGCTGCCTC -3'

Sequencing Primer
(F):5'- TCACAGCTCTAAAGAGATGAGATCTG -3'
(R):5'- ATACCTCATCCTAGAGATGGGCTG -3'
Posted On2014-01-15