Incidental Mutation 'R1199:Cntn4'
ID101204
Institutional Source Beutler Lab
Gene Symbol Cntn4
Ensembl Gene ENSMUSG00000064293
Gene Namecontactin 4
SynonymsBIG-2A, Axcam
MMRRC Submission 039269-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.519) question?
Stock #R1199 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location105677660-106699310 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 106353597 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079416] [ENSMUST00000089208] [ENSMUST00000113258] [ENSMUST00000113260] [ENSMUST00000113261] [ENSMUST00000113264]
Predicted Effect probably benign
Transcript: ENSMUST00000079416
SMART Domains Protein: ENSMUSP00000078385
Gene: ENSMUSG00000064293

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000089208
SMART Domains Protein: ENSMUSP00000086616
Gene: ENSMUSG00000064293

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
FN3 700 786 8.39e0 SMART
FN3 801 886 1.33e-6 SMART
FN3 901 981 9.85e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113258
SMART Domains Protein: ENSMUSP00000108883
Gene: ENSMUSG00000064293

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113260
SMART Domains Protein: ENSMUSP00000108885
Gene: ENSMUSG00000064293

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113261
SMART Domains Protein: ENSMUSP00000108886
Gene: ENSMUSG00000064293

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113264
SMART Domains Protein: ENSMUSP00000108889
Gene: ENSMUSG00000064293

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
FN3 700 786 8.39e0 SMART
FN3 801 886 1.33e-6 SMART
FN3 901 981 9.85e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125904
Meta Mutation Damage Score 0.0556 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the contactin family of immunoglobulins. Contactins are axon-associated cell adhesion molecules that function in neuronal network formation and plasticity. The encoded protein is a glycosylphosphatidylinositol-anchored neuronal membrane protein that may play a role in the formation of axon connections in the developing nervous system. Deletion or mutation of this gene may play a role in 3p deletion syndrome and autism spectrum disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit aberrant projection of olfactory axons to multiple glomeruli in the olfactory bulb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A T 9: 108,393,477 H80L possibly damaging Het
A1bg A T 15: 60,919,635 probably null Het
Aco2 C T 15: 81,895,193 S33L probably damaging Het
Agrn T A 4: 156,172,299 Y1283F probably benign Het
Akap6 T C 12: 52,796,190 V107A probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Btnl9 A T 11: 49,180,747 V83E probably damaging Het
Camk2a T A 18: 60,952,324 C131* probably null Het
Ccdc14 C T 16: 34,723,828 T852M probably damaging Het
Cp T G 3: 19,977,152 S585R probably damaging Het
Cpt1b G A 15: 89,419,010 A614V probably benign Het
Crygn T C 5: 24,751,148 Y153C probably damaging Het
Dennd1a A T 2: 37,961,716 D53E probably damaging Het
Deptor T C 15: 55,252,010 C357R probably benign Het
Dnajc28 C A 16: 91,618,642 probably benign Het
Eml6 G A 11: 29,755,044 A1500V possibly damaging Het
Fgd5 T A 6: 91,986,978 L64Q possibly damaging Het
Fgfbp1 A G 5: 43,979,597 Y118H probably damaging Het
Ftcd G A 10: 76,579,819 R135H probably damaging Het
Gm5174 A T 10: 86,657,325 noncoding transcript Het
Gpr37l1 A T 1: 135,166,972 L178Q probably damaging Het
Gtf2ird1 A G 5: 134,411,064 V104A possibly damaging Het
Irs1 T A 1: 82,289,626 S290C probably damaging Het
Kel C T 6: 41,688,591 V532I possibly damaging Het
Kif1c A G 11: 70,708,601 E442G possibly damaging Het
Klhdc10 T A 6: 30,449,494 V185D probably damaging Het
Lpp C T 16: 24,681,860 R141C probably damaging Het
Olfr1025-ps1 A G 2: 85,918,035 I37V probably benign Het
Olfr68 A T 7: 103,777,985 M120K probably damaging Het
Pcnx2 G T 8: 125,887,314 P466H possibly damaging Het
Pcsk1 A T 13: 75,096,413 probably benign Het
Pkd2l2 T C 18: 34,438,216 probably null Het
Pomt1 A G 2: 32,250,492 N454S probably benign Het
Samhd1 A T 2: 157,109,461 I452N probably damaging Het
Sez6 A G 11: 77,953,885 Q178R probably benign Het
Slc25a44 A G 3: 88,420,986 V66A probably damaging Het
Slc46a2 T C 4: 59,914,189 T245A probably benign Het
Slc4a4 G A 5: 89,215,794 probably null Het
Spata6 T A 4: 111,799,145 C329S possibly damaging Het
Srrm2 A T 17: 23,817,751 probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Svil T A 18: 5,059,217 probably benign Het
Tenm3 G T 8: 48,235,582 S2323R probably damaging Het
Tsc1 G A 2: 28,665,626 R245Q probably damaging Het
Ttn A G 2: 76,908,756 V3813A probably benign Het
Ttn G A 2: 76,950,044 T1121M possibly damaging Het
Ush2a G A 1: 188,759,795 V3094I probably benign Het
Vcan A G 13: 89,679,794 probably null Het
Vmn1r189 A T 13: 22,102,658 L3Q probably damaging Het
Vmn1r60 A C 7: 5,544,972 V43G probably damaging Het
Vmn2r110 A G 17: 20,583,263 I350T probably benign Het
Vmn2r86 T A 10: 130,448,574 probably benign Het
Xrn1 A G 9: 95,981,761 probably benign Het
Zfp251 C T 15: 76,854,236 R219Q possibly damaging Het
Other mutations in Cntn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cntn4 APN 6 106506225 missense probably damaging 1.00
IGL00725:Cntn4 APN 6 106662655 missense probably damaging 1.00
IGL01062:Cntn4 APN 6 106618278 splice site probably benign
IGL01432:Cntn4 APN 6 106678334 splice site probably benign
IGL01585:Cntn4 APN 6 106618328 nonsense probably null
IGL01710:Cntn4 APN 6 106550431 missense possibly damaging 0.87
IGL01870:Cntn4 APN 6 106489715 missense possibly damaging 0.95
IGL01933:Cntn4 APN 6 106694384 missense probably damaging 0.99
IGL01937:Cntn4 APN 6 106437904 missense probably damaging 1.00
IGL01945:Cntn4 APN 6 106437904 missense probably damaging 1.00
IGL02007:Cntn4 APN 6 106655529 missense probably benign 0.03
IGL02506:Cntn4 APN 6 106618388 missense probably benign 0.24
IGL02561:Cntn4 APN 6 106523509 missense probably damaging 1.00
IGL03080:Cntn4 APN 6 106655539 missense probably damaging 1.00
IGL03338:Cntn4 APN 6 106655589 missense probably damaging 0.98
IGL03097:Cntn4 UTSW 6 106353712 missense probably benign 0.10
LCD18:Cntn4 UTSW 6 106553940 intron probably benign
R0083:Cntn4 UTSW 6 106525369 missense possibly damaging 0.79
R0098:Cntn4 UTSW 6 106618424 splice site probably benign
R0501:Cntn4 UTSW 6 106618335 missense probably damaging 1.00
R0626:Cntn4 UTSW 6 106662578 missense probably benign 0.07
R0633:Cntn4 UTSW 6 106679248 splice site probably null
R0730:Cntn4 UTSW 6 106550486 missense probably damaging 1.00
R0849:Cntn4 UTSW 6 106667457 missense probably damaging 1.00
R0883:Cntn4 UTSW 6 106667540 splice site probably benign
R0926:Cntn4 UTSW 6 106655581 missense probably benign 0.21
R1293:Cntn4 UTSW 6 106353724 missense probably benign 0.00
R1296:Cntn4 UTSW 6 106509402 missense probably damaging 1.00
R1344:Cntn4 UTSW 6 106344870 splice site probably null
R1418:Cntn4 UTSW 6 106344870 splice site probably null
R1660:Cntn4 UTSW 6 106679297 missense probably benign 0.35
R1751:Cntn4 UTSW 6 106618410 critical splice donor site probably null
R1883:Cntn4 UTSW 6 106679392 missense probably benign 0.01
R1884:Cntn4 UTSW 6 106679392 missense probably benign 0.01
R1899:Cntn4 UTSW 6 106675813 missense probably benign 0.21
R1906:Cntn4 UTSW 6 106353646 missense probably benign 0.00
R2048:Cntn4 UTSW 6 106437864 splice site probably benign
R2113:Cntn4 UTSW 6 106489697 missense probably damaging 1.00
R3177:Cntn4 UTSW 6 106437964 critical splice donor site probably null
R3277:Cntn4 UTSW 6 106437964 critical splice donor site probably null
R3944:Cntn4 UTSW 6 106618414 missense probably benign 0.10
R4401:Cntn4 UTSW 6 106489664 missense possibly damaging 0.94
R4540:Cntn4 UTSW 6 106675748 missense probably damaging 1.00
R4688:Cntn4 UTSW 6 106437949 missense probably damaging 1.00
R4697:Cntn4 UTSW 6 106525485 missense probably damaging 1.00
R4810:Cntn4 UTSW 6 106655611 missense probably benign 0.04
R4816:Cntn4 UTSW 6 106550497 missense probably benign
R4873:Cntn4 UTSW 6 106437913 missense possibly damaging 0.61
R4875:Cntn4 UTSW 6 106437913 missense possibly damaging 0.61
R4953:Cntn4 UTSW 6 106525418 missense probably benign 0.01
R5288:Cntn4 UTSW 6 106181804 missense possibly damaging 0.60
R5336:Cntn4 UTSW 6 106662634 missense possibly damaging 0.72
R5386:Cntn4 UTSW 6 106181804 missense possibly damaging 0.60
R5477:Cntn4 UTSW 6 106673950 missense possibly damaging 0.88
R5514:Cntn4 UTSW 6 106672883 missense probably damaging 1.00
R5668:Cntn4 UTSW 6 106679436 splice site silent
R6334:Cntn4 UTSW 6 106344786 missense probably benign
R6334:Cntn4 UTSW 6 106506192 missense probably benign 0.29
R6904:Cntn4 UTSW 6 106697583 missense probably benign 0.03
R6985:Cntn4 UTSW 6 106679417 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATTTACTATAGAAGACAGCCCTCTCCCC -3'
(R):5'- TCAGGCTCTATGAAACATACCTCTTTGC -3'

Sequencing Primer
(F):5'- AGCCCTCTCCCCACAAG -3'
(R):5'- CTGTCAGAAGGTACTGTTTGTAAAG -3'
Posted On2014-01-15