Incidental Mutation 'R1200:Nr1h5'
ID101285
Institutional Source Beutler Lab
Gene Symbol Nr1h5
Ensembl Gene ENSMUSG00000048938
Gene Namenuclear receptor subfamily 1, group H, member 5
SynonymsFXRB
MMRRC Submission 039270-MU
Accession Numbers

Ncbi RefSeq: NM_198658.2, NM_201619.2, NM_201622.2

Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R1200 (G1)
Quality Score172
Status Not validated
Chromosome3
Chromosomal Location102939658-102964133 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102947862 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 308 (F308L)
Ref Sequence ENSEMBL: ENSMUSP00000142345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058899] [ENSMUST00000196135] [ENSMUST00000196983] [ENSMUST00000197412] [ENSMUST00000198472]
Predicted Effect probably damaging
Transcript: ENSMUST00000058899
AA Change: F308L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052557
Gene: ENSMUSG00000048938
AA Change: F308L

DomainStartEndE-ValueType
Blast:HOLI 2 47 5e-9 BLAST
ZnF_C4 119 190 2.51e-36 SMART
HOLI 289 474 1.74e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083774
Predicted Effect probably damaging
Transcript: ENSMUST00000196135
AA Change: F250L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143445
Gene: ENSMUSG00000048938
AA Change: F250L

DomainStartEndE-ValueType
ZnF_C4 78 132 1.17e-7 SMART
HOLI 231 416 1.74e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000196983
AA Change: F308L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142799
Gene: ENSMUSG00000048938
AA Change: F308L

DomainStartEndE-ValueType
Blast:HOLI 2 47 5e-9 BLAST
ZnF_C4 119 190 2.51e-36 SMART
HOLI 289 466 1.76e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000197412
AA Change: F308L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143764
Gene: ENSMUSG00000048938
AA Change: F308L

DomainStartEndE-ValueType
Blast:HOLI 2 47 4e-9 BLAST
ZnF_C4 119 190 1e-38 SMART
Pfam:Hormone_recep 274 362 6e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000198472
AA Change: F308L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142345
Gene: ENSMUSG00000048938
AA Change: F308L

DomainStartEndE-ValueType
Blast:HOLI 2 47 4e-9 BLAST
ZnF_C4 119 190 1e-38 SMART
Pfam:Hormone_recep 273 367 5.8e-6 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.2%
Validation Efficiency
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
Abcc2 A T 19: 43,833,987 Q1421H probably damaging Het
Acat1 T A 9: 53,583,510 I361F possibly damaging Het
Akp3 T A 1: 87,125,260 I57N probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Axin2 C A 11: 108,931,550 D309E probably damaging Het
Clstn3 G T 6: 124,459,170 P207T probably damaging Het
Dip2b C A 15: 100,209,745 A1212E probably benign Het
Dnah5 A G 15: 28,246,257 I580M possibly damaging Het
Dpp3 T C 19: 4,923,129 T146A probably benign Het
Fam227a A G 15: 79,612,537 F613S possibly damaging Het
Fam83b T C 9: 76,492,312 D503G probably damaging Het
Flot2 C T 11: 78,054,805 T2M probably damaging Het
Herc1 T C 9: 66,486,124 L4095S probably damaging Het
Kcnh7 T C 2: 62,777,395 Y614C probably damaging Het
Lcp1 T A 14: 75,229,302 F616L possibly damaging Het
Myh15 T A 16: 49,096,519 Y401N probably damaging Het
Neb T C 2: 52,167,645 Y6144C probably damaging Het
Ntn5 G T 7: 45,692,382 V309L possibly damaging Het
Olfr1053 A T 2: 86,315,133 L51Q probably damaging Het
Olfr612 T A 7: 103,539,067 T56S probably benign Het
Pex1 G A 5: 3,606,411 probably null Het
Pld1 A T 3: 28,049,286 D380V probably damaging Het
Prdm1 A G 10: 44,450,130 Y148H probably damaging Het
Ptchd3 T C 11: 121,831,261 probably null Het
Rnf17 C T 14: 56,467,706 T689I probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Twf1 A T 15: 94,586,358 H94Q probably benign Het
Vmn2r13 T G 5: 109,174,202 I210L probably damaging Het
Zbtb49 T C 5: 38,213,331 E402G probably damaging Het
Other mutations in Nr1h5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01829:Nr1h5 APN 3 102949079 missense probably benign 0.02
IGL02021:Nr1h5 APN 3 102947742 intron probably benign
IGL02025:Nr1h5 APN 3 102949626 splice site probably benign
IGL02094:Nr1h5 APN 3 102952196 nonsense probably null
R0035:Nr1h5 UTSW 3 102949573 nonsense probably null
R0035:Nr1h5 UTSW 3 102949573 nonsense probably null
R1977:Nr1h5 UTSW 3 102947817 missense probably damaging 1.00
R4173:Nr1h5 UTSW 3 102952230 missense probably damaging 1.00
R4556:Nr1h5 UTSW 3 102946141 missense probably benign 0.28
R5018:Nr1h5 UTSW 3 102947795 missense probably damaging 1.00
R5471:Nr1h5 UTSW 3 102949126 missense possibly damaging 0.74
R5617:Nr1h5 UTSW 3 102947829 missense probably damaging 1.00
R5822:Nr1h5 UTSW 3 102949328 missense probably damaging 1.00
R6243:Nr1h5 UTSW 3 102949064 missense probably benign 0.00
R6442:Nr1h5 UTSW 3 102941111 missense probably damaging 1.00
R6754:Nr1h5 UTSW 3 102949597 missense probably damaging 1.00
R6789:Nr1h5 UTSW 3 102958361 missense possibly damaging 0.81
R7235:Nr1h5 UTSW 3 102949042 critical splice donor site probably null
R7294:Nr1h5 UTSW 3 102945262 missense probably benign 0.00
X0061:Nr1h5 UTSW 3 102945248 splice site probably null
X0067:Nr1h5 UTSW 3 102949126 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TCTAAGGAGCACAGAAGCCCCA -3'
(R):5'- CCTAGTGCTGATAAAAGTGCCCCAAA -3'

Sequencing Primer
(F):5'- gtccccagcaccatagaag -3'
(R):5'- AAAGTGCCCCAAAATAGAAAAAAAG -3'
Posted On2014-01-15