Incidental Mutation 'R1200:Pex1'
ID101287
Institutional Source Beutler Lab
Gene Symbol Pex1
Ensembl Gene ENSMUSG00000005907
Gene Nameperoxisomal biogenesis factor 1
Synonymsperoxisome biogenesis factor 1, ZWS1
MMRRC Submission 039270-MU
Accession Numbers

Genbank: NM_027777

Is this an essential gene? Possibly essential (E-score: 0.590) question?
Stock #R1200 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location3596066-3637232 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 3606411 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000006061] [ENSMUST00000121291] [ENSMUST00000142516] [ENSMUST00000195894]
Predicted Effect probably null
Transcript: ENSMUST00000006061
SMART Domains Protein: ENSMUSP00000006061
Gene: ENSMUSG00000005907

DomainStartEndE-ValueType
Pfam:PEX-2N 14 99 2.4e-53 PFAM
Pfam:PEX-1N 103 179 8.6e-27 PFAM
low complexity region 508 527 N/A INTRINSIC
AAA 552 702 1.39e-10 SMART
low complexity region 754 765 N/A INTRINSIC
AAA 834 970 4.07e-17 SMART
low complexity region 1024 1044 N/A INTRINSIC
low complexity region 1051 1061 N/A INTRINSIC
low complexity region 1065 1078 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121291
SMART Domains Protein: ENSMUSP00000113304
Gene: ENSMUSG00000005907

DomainStartEndE-ValueType
Pfam:PEX-2N 17 98 8.7e-38 PFAM
Pfam:PEX-1N 104 179 1.4e-27 PFAM
low complexity region 548 567 N/A INTRINSIC
AAA 592 742 1.39e-10 SMART
low complexity region 794 805 N/A INTRINSIC
AAA 874 1010 4.07e-17 SMART
low complexity region 1064 1084 N/A INTRINSIC
low complexity region 1091 1101 N/A INTRINSIC
low complexity region 1105 1118 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123268
Predicted Effect probably null
Transcript: ENSMUST00000126545
SMART Domains Protein: ENSMUSP00000121813
Gene: ENSMUSG00000005907

DomainStartEndE-ValueType
low complexity region 88 107 N/A INTRINSIC
Pfam:AAA 136 212 2.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142516
SMART Domains Protein: ENSMUSP00000116474
Gene: ENSMUSG00000005907

DomainStartEndE-ValueType
PDB:1WLF|A 1 21 5e-8 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143959
Predicted Effect probably benign
Transcript: ENSMUST00000195894
SMART Domains Protein: ENSMUSP00000142620
Gene: ENSMUSG00000005907

DomainStartEndE-ValueType
Pfam:PEX-2N 14 99 2.5e-51 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA ATPase family, a large group of ATPases associated with diverse cellular activities. This protein is cytoplasmic but is often anchored to a peroxisomal membrane where it forms a heteromeric complex and plays a role in the import of proteins into peroxisomes and peroxisome biogenesis. Mutations in this gene have been associated with complementation group 1 peroxisomal disorders such as neonatal adrenoleukodystrophy, infantile Refsum disease, and Zellweger syndrome. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-in allele display premature death, postnatal growth retardation, fatty livers, a bile acid defect associated with intestinal lipid malabsorption and cholestasis, and a retinopathy associated with retinal cone cell degenerationand abnormal cone and rod electrophysiology. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, other(2) Gene trapped(2)

Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
Abcc2 A T 19: 43,833,987 Q1421H probably damaging Het
Acat1 T A 9: 53,583,510 I361F possibly damaging Het
Akp3 T A 1: 87,125,260 I57N probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Axin2 C A 11: 108,931,550 D309E probably damaging Het
Clstn3 G T 6: 124,459,170 P207T probably damaging Het
Dip2b C A 15: 100,209,745 A1212E probably benign Het
Dnah5 A G 15: 28,246,257 I580M possibly damaging Het
Dpp3 T C 19: 4,923,129 T146A probably benign Het
Fam227a A G 15: 79,612,537 F613S possibly damaging Het
Fam83b T C 9: 76,492,312 D503G probably damaging Het
Flot2 C T 11: 78,054,805 T2M probably damaging Het
Herc1 T C 9: 66,486,124 L4095S probably damaging Het
Kcnh7 T C 2: 62,777,395 Y614C probably damaging Het
Lcp1 T A 14: 75,229,302 F616L possibly damaging Het
Myh15 T A 16: 49,096,519 Y401N probably damaging Het
Neb T C 2: 52,167,645 Y6144C probably damaging Het
Nr1h5 A G 3: 102,947,862 F308L probably damaging Het
Ntn5 G T 7: 45,692,382 V309L possibly damaging Het
Olfr1053 A T 2: 86,315,133 L51Q probably damaging Het
Olfr612 T A 7: 103,539,067 T56S probably benign Het
Pld1 A T 3: 28,049,286 D380V probably damaging Het
Prdm1 A G 10: 44,450,130 Y148H probably damaging Het
Ptchd3 T C 11: 121,831,261 probably null Het
Rnf17 C T 14: 56,467,706 T689I probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Twf1 A T 15: 94,586,358 H94Q probably benign Het
Vmn2r13 T G 5: 109,174,202 I210L probably damaging Het
Zbtb49 T C 5: 38,213,331 E402G probably damaging Het
Other mutations in Pex1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Pex1 APN 5 3606027 missense probably benign 0.00
IGL01315:Pex1 APN 5 3609975 missense probably damaging 1.00
IGL01671:Pex1 APN 5 3624088 missense probably benign 0.00
IGL01863:Pex1 APN 5 3606066 missense probably benign 0.01
IGL01933:Pex1 APN 5 3633789 missense probably damaging 1.00
IGL01960:Pex1 APN 5 3627588 unclassified probably benign
IGL02347:Pex1 APN 5 3603350 missense probably damaging 0.98
IGL02374:Pex1 APN 5 3635481 missense probably benign 0.01
IGL02392:Pex1 APN 5 3605952 nonsense probably null
IGL02597:Pex1 APN 5 3635865 missense possibly damaging 0.50
IGL02703:Pex1 APN 5 3615120 missense probably benign 0.24
IGL02815:Pex1 APN 5 3636797 missense probably damaging 0.97
IGL02862:Pex1 APN 5 3605424 intron probably benign
IGL03005:Pex1 APN 5 3630292 missense probably null 0.96
E0370:Pex1 UTSW 5 3631614 unclassified probably null
F5493:Pex1 UTSW 5 3635912 critical splice donor site probably null
R0014:Pex1 UTSW 5 3626141 unclassified probably benign
R0014:Pex1 UTSW 5 3626141 unclassified probably benign
R0401:Pex1 UTSW 5 3633759 missense probably damaging 1.00
R0480:Pex1 UTSW 5 3606444 intron probably null
R0555:Pex1 UTSW 5 3606130 missense possibly damaging 0.89
R0976:Pex1 UTSW 5 3633943 missense probably benign 0.00
R1672:Pex1 UTSW 5 3626085 missense probably damaging 1.00
R1753:Pex1 UTSW 5 3630044 missense probably damaging 1.00
R1880:Pex1 UTSW 5 3605770 missense probably benign
R1953:Pex1 UTSW 5 3630038 missense probably damaging 1.00
R2054:Pex1 UTSW 5 3603341 missense possibly damaging 0.78
R2081:Pex1 UTSW 5 3624132 critical splice donor site probably null
R2237:Pex1 UTSW 5 3618915 critical splice donor site probably null
R3946:Pex1 UTSW 5 3626084 missense probably damaging 1.00
R4528:Pex1 UTSW 5 3631712 missense probably damaging 1.00
R4579:Pex1 UTSW 5 3618880 missense probably benign 0.03
R4585:Pex1 UTSW 5 3633885 missense probably damaging 1.00
R4586:Pex1 UTSW 5 3633885 missense probably damaging 1.00
R4656:Pex1 UTSW 5 3604880 critical splice donor site probably null
R4789:Pex1 UTSW 5 3630270 missense probably damaging 0.98
R4850:Pex1 UTSW 5 3624426 missense probably benign
R4963:Pex1 UTSW 5 3609924 missense probably benign 0.01
R5005:Pex1 UTSW 5 3622310 missense probably damaging 1.00
R5015:Pex1 UTSW 5 3620597 missense probably damaging 1.00
R5019:Pex1 UTSW 5 3622331 missense probably damaging 1.00
R5937:Pex1 UTSW 5 3624487 missense possibly damaging 0.94
R5942:Pex1 UTSW 5 3610277 missense probably benign 0.04
R5995:Pex1 UTSW 5 3607704 missense possibly damaging 0.53
R6434:Pex1 UTSW 5 3630196 nonsense probably null
R6552:Pex1 UTSW 5 3623953 missense probably damaging 1.00
R6777:Pex1 UTSW 5 3622358 missense probably benign 0.01
R6877:Pex1 UTSW 5 3635505 missense probably benign 0.19
R6948:Pex1 UTSW 5 3605994 missense probably benign 0.00
R7317:Pex1 UTSW 5 3618875 missense probably damaging 1.00
X0019:Pex1 UTSW 5 3605653 missense probably damaging 1.00
X0027:Pex1 UTSW 5 3630270 missense probably damaging 0.98
Z1088:Pex1 UTSW 5 3606075 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGTTTCACAAACACTGCACCGC -3'
(R):5'- TAAAGAGGGACTGGAGACACTGCTC -3'

Sequencing Primer
(F):5'- TCCTGTTGCCTGACAAAGAG -3'
(R):5'- GAGACACTGCTCGCTCCAC -3'
Posted On2014-01-15