Incidental Mutation 'R1200:Zbtb49'
ID101289
Institutional Source Beutler Lab
Gene Symbol Zbtb49
Ensembl Gene ENSMUSG00000029127
Gene Namezinc finger and BTB domain containing 49
SynonymsZfp509, 4930518A03Rik
MMRRC Submission 039270-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R1200 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location38189735-38220457 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38213331 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 402 (E402G)
Ref Sequence ENSEMBL: ENSMUSP00000117174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094833] [ENSMUST00000114113] [ENSMUST00000123106] [ENSMUST00000126267] [ENSMUST00000136475] [ENSMUST00000138820] [ENSMUST00000143436]
Predicted Effect probably damaging
Transcript: ENSMUST00000094833
AA Change: E402G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092429
Gene: ENSMUSG00000029127
AA Change: E402G

DomainStartEndE-ValueType
BTB 25 121 2.97e-23 SMART
ZnF_C2H2 386 408 1.38e-3 SMART
ZnF_C2H2 414 436 6.99e-5 SMART
ZnF_C2H2 442 464 2.24e-3 SMART
ZnF_C2H2 470 492 1.26e-2 SMART
ZnF_C2H2 498 520 5.14e-3 SMART
ZnF_C2H2 526 548 2.27e-4 SMART
ZnF_C2H2 554 576 3.39e-3 SMART
low complexity region 597 614 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114113
AA Change: E402G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109748
Gene: ENSMUSG00000029127
AA Change: E402G

DomainStartEndE-ValueType
BTB 25 121 2.97e-23 SMART
ZnF_C2H2 386 408 1.38e-3 SMART
low complexity region 413 430 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123106
SMART Domains Protein: ENSMUSP00000144200
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
Pfam:BTB 12 51 1.6e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000126267
AA Change: E402G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122109
Gene: ENSMUSG00000029127
AA Change: E402G

DomainStartEndE-ValueType
BTB 25 121 2.97e-23 SMART
ZnF_C2H2 386 408 1.38e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000129161
AA Change: S74G
Predicted Effect probably damaging
Transcript: ENSMUST00000136475
AA Change: E402G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117174
Gene: ENSMUSG00000029127
AA Change: E402G

DomainStartEndE-ValueType
BTB 25 121 2.97e-23 SMART
ZnF_C2H2 386 408 1.38e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137577
Predicted Effect probably benign
Transcript: ENSMUST00000138820
SMART Domains Protein: ENSMUSP00000117913
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
Pfam:BTB 13 63 4.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143436
SMART Domains Protein: ENSMUSP00000115513
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
Pfam:BTB 15 75 1.5e-11 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
Abcc2 A T 19: 43,833,987 Q1421H probably damaging Het
Acat1 T A 9: 53,583,510 I361F possibly damaging Het
Akp3 T A 1: 87,125,260 I57N probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Axin2 C A 11: 108,931,550 D309E probably damaging Het
Clstn3 G T 6: 124,459,170 P207T probably damaging Het
Dip2b C A 15: 100,209,745 A1212E probably benign Het
Dnah5 A G 15: 28,246,257 I580M possibly damaging Het
Dpp3 T C 19: 4,923,129 T146A probably benign Het
Fam227a A G 15: 79,612,537 F613S possibly damaging Het
Fam83b T C 9: 76,492,312 D503G probably damaging Het
Flot2 C T 11: 78,054,805 T2M probably damaging Het
Herc1 T C 9: 66,486,124 L4095S probably damaging Het
Kcnh7 T C 2: 62,777,395 Y614C probably damaging Het
Lcp1 T A 14: 75,229,302 F616L possibly damaging Het
Myh15 T A 16: 49,096,519 Y401N probably damaging Het
Neb T C 2: 52,167,645 Y6144C probably damaging Het
Nr1h5 A G 3: 102,947,862 F308L probably damaging Het
Ntn5 G T 7: 45,692,382 V309L possibly damaging Het
Olfr1053 A T 2: 86,315,133 L51Q probably damaging Het
Olfr612 T A 7: 103,539,067 T56S probably benign Het
Pex1 G A 5: 3,606,411 probably null Het
Pld1 A T 3: 28,049,286 D380V probably damaging Het
Prdm1 A G 10: 44,450,130 Y148H probably damaging Het
Ptchd3 T C 11: 121,831,261 probably null Het
Rnf17 C T 14: 56,467,706 T689I probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Twf1 A T 15: 94,586,358 H94Q probably benign Het
Vmn2r13 T G 5: 109,174,202 I210L probably damaging Het
Other mutations in Zbtb49
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01355:Zbtb49 APN 5 38210616 critical splice donor site probably null
IGL01736:Zbtb49 APN 5 38200860 missense probably damaging 1.00
PIT4585001:Zbtb49 UTSW 5 38216476 missense probably damaging 1.00
R0443:Zbtb49 UTSW 5 38200830 missense probably benign 0.08
R0526:Zbtb49 UTSW 5 38213919 missense probably benign 0.08
R0646:Zbtb49 UTSW 5 38200674 missense probably damaging 1.00
R1678:Zbtb49 UTSW 5 38213694 missense probably damaging 0.97
R1964:Zbtb49 UTSW 5 38203761 nonsense probably null
R2155:Zbtb49 UTSW 5 38214120 missense possibly damaging 0.86
R2483:Zbtb49 UTSW 5 38203357 intron probably benign
R3617:Zbtb49 UTSW 5 38200631 unclassified probably benign
R4937:Zbtb49 UTSW 5 38213963 missense possibly damaging 0.76
R5579:Zbtb49 UTSW 5 38200816 missense probably damaging 0.99
R5699:Zbtb49 UTSW 5 38216526 missense probably damaging 1.00
R6354:Zbtb49 UTSW 5 38203559 missense possibly damaging 0.58
R6426:Zbtb49 UTSW 5 38203087 unclassified probably null
R6735:Zbtb49 UTSW 5 38201058 missense possibly damaging 0.74
R6805:Zbtb49 UTSW 5 38213241 intron probably benign
R6869:Zbtb49 UTSW 5 38214350 missense probably damaging 1.00
R7020:Zbtb49 UTSW 5 38213367 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCTTGATGATGCTCCCTGCAC -3'
(R):5'- CACCCTGAGCCAGATAATGGGTTG -3'

Sequencing Primer
(F):5'- TGATGCTCCCTGCACAGAAC -3'
(R):5'- TCTGCTGCTAAGGAAGATGC -3'
Posted On2014-01-15