Incidental Mutation 'R1200:Olfr612'
ID101297
Institutional Source Beutler Lab
Gene Symbol Olfr612
Ensembl Gene ENSMUSG00000094119
Gene Nameolfactory receptor 612
SynonymsMOR15-3, GA_x6K02T2PBJ9-6251685-6250741, EG545985
MMRRC Submission 039270-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R1200 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location103537222-103542717 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103539067 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 56 (T56S)
Ref Sequence ENSEMBL: ENSMUSP00000149996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104879] [ENSMUST00000214269] [ENSMUST00000215663]
Predicted Effect probably benign
Transcript: ENSMUST00000104879
AA Change: T56S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000100473
Gene: ENSMUSG00000094119
AA Change: T56S

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 1.3e-109 PFAM
Pfam:7TM_GPCR_Srsx 37 309 4.7e-11 PFAM
Pfam:7tm_1 43 294 3.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214269
AA Change: T56S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000215663
AA Change: T56S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
Abcc2 A T 19: 43,833,987 Q1421H probably damaging Het
Acat1 T A 9: 53,583,510 I361F possibly damaging Het
Akp3 T A 1: 87,125,260 I57N probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Axin2 C A 11: 108,931,550 D309E probably damaging Het
Clstn3 G T 6: 124,459,170 P207T probably damaging Het
Dip2b C A 15: 100,209,745 A1212E probably benign Het
Dnah5 A G 15: 28,246,257 I580M possibly damaging Het
Dpp3 T C 19: 4,923,129 T146A probably benign Het
Fam227a A G 15: 79,612,537 F613S possibly damaging Het
Fam83b T C 9: 76,492,312 D503G probably damaging Het
Flot2 C T 11: 78,054,805 T2M probably damaging Het
Herc1 T C 9: 66,486,124 L4095S probably damaging Het
Kcnh7 T C 2: 62,777,395 Y614C probably damaging Het
Lcp1 T A 14: 75,229,302 F616L possibly damaging Het
Myh15 T A 16: 49,096,519 Y401N probably damaging Het
Neb T C 2: 52,167,645 Y6144C probably damaging Het
Nr1h5 A G 3: 102,947,862 F308L probably damaging Het
Ntn5 G T 7: 45,692,382 V309L possibly damaging Het
Olfr1053 A T 2: 86,315,133 L51Q probably damaging Het
Pex1 G A 5: 3,606,411 probably null Het
Pld1 A T 3: 28,049,286 D380V probably damaging Het
Prdm1 A G 10: 44,450,130 Y148H probably damaging Het
Ptchd3 T C 11: 121,831,261 probably null Het
Rnf17 C T 14: 56,467,706 T689I probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Twf1 A T 15: 94,586,358 H94Q probably benign Het
Vmn2r13 T G 5: 109,174,202 I210L probably damaging Het
Zbtb49 T C 5: 38,213,331 E402G probably damaging Het
Other mutations in Olfr612
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01808:Olfr612 APN 7 103538574 missense probably damaging 1.00
IGL01901:Olfr612 APN 7 103538970 missense probably damaging 0.98
R1591:Olfr612 UTSW 7 103539067 missense probably benign 0.00
R1858:Olfr612 UTSW 7 103538652 missense probably damaging 1.00
R1975:Olfr612 UTSW 7 103538994 missense probably damaging 1.00
R1994:Olfr612 UTSW 7 103538359 missense possibly damaging 0.57
R3690:Olfr612 UTSW 7 103539067 missense probably benign 0.01
R4635:Olfr612 UTSW 7 103539148 missense probably benign 0.00
R4670:Olfr612 UTSW 7 103539186 missense possibly damaging 0.89
R5267:Olfr612 UTSW 7 103538824 missense probably benign 0.19
R5417:Olfr612 UTSW 7 103538763 missense possibly damaging 0.94
R6644:Olfr612 UTSW 7 103539058 missense possibly damaging 0.94
R7253:Olfr612 UTSW 7 103538788 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGCACCTGCACAGTTAAGGTTC -3'
(R):5'- CCTGACAACATGCTTCATGTCAACATC -3'

Sequencing Primer
(F):5'- AGCCTATCTTGGCAATCACAGTG -3'
(R):5'- TGCTTCATGTCAACATCACCAAC -3'
Posted On2014-01-15