Incidental Mutation 'R1200:Acat1'
ID101299
Institutional Source Beutler Lab
Gene Symbol Acat1
Ensembl Gene ENSMUSG00000032047
Gene Nameacetyl-Coenzyme A acetyltransferase 1
Synonyms6330585C21Rik, Acat
MMRRC Submission 039270-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.416) question?
Stock #R1200 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location53580522-53610382 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 53583510 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 361 (I361F)
Ref Sequence ENSEMBL: ENSMUSP00000034547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034547]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034547
AA Change: I361F

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034547
Gene: ENSMUSG00000032047
AA Change: I361F

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
Pfam:Thiolase_N 39 296 3.7e-98 PFAM
Pfam:ketoacyl-synt 104 166 1.1e-8 PFAM
Pfam:Thiolase_C 303 423 1.5e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169317
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrially localized enzyme that catalyzes the reversible formation of acetoacetyl-CoA from two molecules of acetyl-CoA. Defects in this gene are associated with 3-ketothiolase deficiency, an inborn error of isoleucine catabolism characterized by urinary excretion of 2-methyl-3-hydroxybutyric acid, 2-methylacetoacetic acid, tiglylglycine, and butanone. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
Abcc2 A T 19: 43,833,987 Q1421H probably damaging Het
Akp3 T A 1: 87,125,260 I57N probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Axin2 C A 11: 108,931,550 D309E probably damaging Het
Clstn3 G T 6: 124,459,170 P207T probably damaging Het
Dip2b C A 15: 100,209,745 A1212E probably benign Het
Dnah5 A G 15: 28,246,257 I580M possibly damaging Het
Dpp3 T C 19: 4,923,129 T146A probably benign Het
Fam227a A G 15: 79,612,537 F613S possibly damaging Het
Fam83b T C 9: 76,492,312 D503G probably damaging Het
Flot2 C T 11: 78,054,805 T2M probably damaging Het
Herc1 T C 9: 66,486,124 L4095S probably damaging Het
Kcnh7 T C 2: 62,777,395 Y614C probably damaging Het
Lcp1 T A 14: 75,229,302 F616L possibly damaging Het
Myh15 T A 16: 49,096,519 Y401N probably damaging Het
Neb T C 2: 52,167,645 Y6144C probably damaging Het
Nr1h5 A G 3: 102,947,862 F308L probably damaging Het
Ntn5 G T 7: 45,692,382 V309L possibly damaging Het
Olfr1053 A T 2: 86,315,133 L51Q probably damaging Het
Olfr612 T A 7: 103,539,067 T56S probably benign Het
Pex1 G A 5: 3,606,411 probably null Het
Pld1 A T 3: 28,049,286 D380V probably damaging Het
Prdm1 A G 10: 44,450,130 Y148H probably damaging Het
Ptchd3 T C 11: 121,831,261 probably null Het
Rnf17 C T 14: 56,467,706 T689I probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Twf1 A T 15: 94,586,358 H94Q probably benign Het
Vmn2r13 T G 5: 109,174,202 I210L probably damaging Het
Zbtb49 T C 5: 38,213,331 E402G probably damaging Het
Other mutations in Acat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Acat1 APN 9 53582595 missense probably damaging 0.98
IGL02160:Acat1 APN 9 53591987 missense probably benign 0.00
IGL02246:Acat1 APN 9 53584866 missense probably benign 0.06
IGL02582:Acat1 APN 9 53594745 missense probably benign 0.37
IGL03028:Acat1 APN 9 53594762 missense probably benign 0.14
R0637:Acat1 UTSW 9 53587531 missense probably damaging 1.00
R1302:Acat1 UTSW 9 53589225 missense possibly damaging 0.70
R1331:Acat1 UTSW 9 53584883 missense probably benign 0.10
R3683:Acat1 UTSW 9 53587465 missense probably damaging 1.00
R4829:Acat1 UTSW 9 53591456 missense probably damaging 1.00
R5035:Acat1 UTSW 9 53583510 missense probably benign 0.00
R5354:Acat1 UTSW 9 53589183 missense possibly damaging 0.91
R5411:Acat1 UTSW 9 53582646 missense probably damaging 1.00
R5521:Acat1 UTSW 9 53583507 nonsense probably null
R5634:Acat1 UTSW 9 53583621 intron probably benign
R5905:Acat1 UTSW 9 53592066 missense probably damaging 1.00
R6028:Acat1 UTSW 9 53592066 missense probably damaging 1.00
R6925:Acat1 UTSW 9 53592029 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GCAGTCGTGTTTCAAGCCACAG -3'
(R):5'- GATGCGTGGCAACAGACAAAACTATC -3'

Sequencing Primer
(F):5'- CCACAGAAGTGCTAACTGTGTTC -3'
(R):5'- CACCTTTTCAAACATCTGTGGAGAC -3'
Posted On2014-01-15