Incidental Mutation 'R1200:Fam83b'
ID101303
Institutional Source Beutler Lab
Gene Symbol Fam83b
Ensembl Gene ENSMUSG00000032358
Gene Namefamily with sequence similarity 83, member B
SynonymsC530008M07Rik
MMRRC Submission 039270-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R1200 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location76490054-76567116 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76492312 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 503 (D503G)
Ref Sequence ENSEMBL: ENSMUSP00000139354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098546] [ENSMUST00000183437]
Predicted Effect probably damaging
Transcript: ENSMUST00000098546
AA Change: D503G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096146
Gene: ENSMUSG00000032358
AA Change: D503G

DomainStartEndE-ValueType
Pfam:DUF1669 12 282 5.6e-109 PFAM
Pfam:PLDc_2 139 277 2.4e-12 PFAM
low complexity region 557 574 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
low complexity region 747 760 N/A INTRINSIC
low complexity region 826 846 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183437
AA Change: D503G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139354
Gene: ENSMUSG00000032358
AA Change: D503G

DomainStartEndE-ValueType
Pfam:DUF1669 7 283 2.8e-111 PFAM
Pfam:PLDc_2 139 277 2.4e-9 PFAM
low complexity region 557 574 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
low complexity region 747 760 N/A INTRINSIC
low complexity region 826 846 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
Abcc2 A T 19: 43,833,987 Q1421H probably damaging Het
Acat1 T A 9: 53,583,510 I361F possibly damaging Het
Akp3 T A 1: 87,125,260 I57N probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Axin2 C A 11: 108,931,550 D309E probably damaging Het
Clstn3 G T 6: 124,459,170 P207T probably damaging Het
Dip2b C A 15: 100,209,745 A1212E probably benign Het
Dnah5 A G 15: 28,246,257 I580M possibly damaging Het
Dpp3 T C 19: 4,923,129 T146A probably benign Het
Fam227a A G 15: 79,612,537 F613S possibly damaging Het
Flot2 C T 11: 78,054,805 T2M probably damaging Het
Herc1 T C 9: 66,486,124 L4095S probably damaging Het
Kcnh7 T C 2: 62,777,395 Y614C probably damaging Het
Lcp1 T A 14: 75,229,302 F616L possibly damaging Het
Myh15 T A 16: 49,096,519 Y401N probably damaging Het
Neb T C 2: 52,167,645 Y6144C probably damaging Het
Nr1h5 A G 3: 102,947,862 F308L probably damaging Het
Ntn5 G T 7: 45,692,382 V309L possibly damaging Het
Olfr1053 A T 2: 86,315,133 L51Q probably damaging Het
Olfr612 T A 7: 103,539,067 T56S probably benign Het
Pex1 G A 5: 3,606,411 probably null Het
Pld1 A T 3: 28,049,286 D380V probably damaging Het
Prdm1 A G 10: 44,450,130 Y148H probably damaging Het
Ptchd3 T C 11: 121,831,261 probably null Het
Rnf17 C T 14: 56,467,706 T689I probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Twf1 A T 15: 94,586,358 H94Q probably benign Het
Vmn2r13 T G 5: 109,174,202 I210L probably damaging Het
Zbtb49 T C 5: 38,213,331 E402G probably damaging Het
Other mutations in Fam83b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Fam83b APN 9 76490978 missense probably benign 0.00
IGL01554:Fam83b APN 9 76502121 missense probably benign 0.33
IGL01694:Fam83b APN 9 76490990 missense probably benign 0.13
IGL02009:Fam83b APN 9 76492322 missense probably damaging 1.00
IGL02531:Fam83b APN 9 76492000 missense possibly damaging 0.61
IGL03328:Fam83b APN 9 76493042 missense probably benign 0.01
PIT4581001:Fam83b UTSW 9 76491152 missense probably damaging 1.00
R0110:Fam83b UTSW 9 76492826 missense possibly damaging 0.75
R0469:Fam83b UTSW 9 76492826 missense possibly damaging 0.75
R0510:Fam83b UTSW 9 76492826 missense possibly damaging 0.75
R0732:Fam83b UTSW 9 76492928 nonsense probably null
R0946:Fam83b UTSW 9 76491397 missense probably damaging 0.96
R0961:Fam83b UTSW 9 76491295 missense probably damaging 0.97
R1101:Fam83b UTSW 9 76545670 missense possibly damaging 0.68
R1248:Fam83b UTSW 9 76503076 missense probably benign 0.35
R1420:Fam83b UTSW 9 76492612 missense possibly damaging 0.94
R1429:Fam83b UTSW 9 76492577 missense probably benign
R1939:Fam83b UTSW 9 76493080 missense probably damaging 1.00
R1992:Fam83b UTSW 9 76492022 missense probably benign
R2102:Fam83b UTSW 9 76492705 missense probably damaging 0.96
R2134:Fam83b UTSW 9 76491016 missense probably damaging 1.00
R2398:Fam83b UTSW 9 76502218 missense probably damaging 1.00
R2878:Fam83b UTSW 9 76490810 missense probably damaging 1.00
R4092:Fam83b UTSW 9 76491661 missense probably benign 0.24
R4204:Fam83b UTSW 9 76503053 missense probably benign 0.09
R4537:Fam83b UTSW 9 76492142 missense probably benign 0.10
R4920:Fam83b UTSW 9 76491868 missense probably benign
R5456:Fam83b UTSW 9 76492595 missense probably benign
R5473:Fam83b UTSW 9 76491500 missense probably damaging 1.00
R5488:Fam83b UTSW 9 76545599 missense probably benign 0.05
R5489:Fam83b UTSW 9 76545599 missense probably benign 0.05
R5876:Fam83b UTSW 9 76491850 missense possibly damaging 0.92
R6150:Fam83b UTSW 9 76492357 missense probably damaging 1.00
R6374:Fam83b UTSW 9 76492907 missense probably benign 0.31
R6468:Fam83b UTSW 9 76502131 nonsense probably null
R6912:Fam83b UTSW 9 76490932 missense probably damaging 0.99
R7022:Fam83b UTSW 9 76502112 frame shift probably null
R7073:Fam83b UTSW 9 76545749 missense probably benign 0.18
R7356:Fam83b UTSW 9 76492853 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCGCTTCCTTGAGAACCGATGATG -3'
(R):5'- ACCAATAATGCTCCTGGACGCTG -3'

Sequencing Primer
(F):5'- AACCGATGATGGTGGAATTTG -3'
(R):5'- GCCTTCAGACAGTCTCAGTGTAG -3'
Posted On2014-01-15