Incidental Mutation 'R1200:Prdm1'
ID101307
Institutional Source Beutler Lab
Gene Symbol Prdm1
Ensembl Gene ENSMUSG00000038151
Gene NamePR domain containing 1, with ZNF domain
SynonymsBlimp1, b2b1765Clo, Blimp-1, PRDI-BF1
MMRRC Submission 039270-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1200 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location44437177-44528501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44450130 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 148 (Y148H)
Ref Sequence ENSEMBL: ENSMUSP00000151237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039174] [ENSMUST00000105490] [ENSMUST00000218369]
Predicted Effect probably damaging
Transcript: ENSMUST00000039174
AA Change: Y166H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039248
Gene: ENSMUSG00000038151
AA Change: Y166H

DomainStartEndE-ValueType
SET 118 239 1.1e-19 SMART
low complexity region 359 393 N/A INTRINSIC
low complexity region 541 556 N/A INTRINSIC
ZnF_C2H2 606 628 6.42e-4 SMART
ZnF_C2H2 634 656 3.89e-3 SMART
ZnF_C2H2 662 684 7.26e-3 SMART
ZnF_C2H2 690 712 1.36e-2 SMART
ZnF_C2H2 718 738 1.12e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105490
AA Change: Y133H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101129
Gene: ENSMUSG00000038151
AA Change: Y133H

DomainStartEndE-ValueType
SET 85 206 1.1e-19 SMART
low complexity region 326 360 N/A INTRINSIC
low complexity region 508 523 N/A INTRINSIC
ZnF_C2H2 573 595 6.42e-4 SMART
ZnF_C2H2 601 623 3.89e-3 SMART
ZnF_C2H2 629 651 7.26e-3 SMART
ZnF_C2H2 657 679 1.36e-2 SMART
ZnF_C2H2 685 705 1.12e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167340
Predicted Effect probably damaging
Transcript: ENSMUST00000218369
AA Change: Y148H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that acts as a repressor of beta-interferon gene expression. The protein binds specifically to the PRDI (positive regulatory domain I element) of the beta-IFN gene promoter. Transcription of this gene increases upon virus induction. Two alternatively spliced transcript variants that encode different isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality and impaired primordial germ cell development, while heterozygotes display a decreased numbers of primordial germ cells but normal migration. Conditional mutants display impaired plasma cell and pre-plasmamemory B cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
Abcc2 A T 19: 43,833,987 Q1421H probably damaging Het
Acat1 T A 9: 53,583,510 I361F possibly damaging Het
Akp3 T A 1: 87,125,260 I57N probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Axin2 C A 11: 108,931,550 D309E probably damaging Het
Clstn3 G T 6: 124,459,170 P207T probably damaging Het
Dip2b C A 15: 100,209,745 A1212E probably benign Het
Dnah5 A G 15: 28,246,257 I580M possibly damaging Het
Dpp3 T C 19: 4,923,129 T146A probably benign Het
Fam227a A G 15: 79,612,537 F613S possibly damaging Het
Fam83b T C 9: 76,492,312 D503G probably damaging Het
Flot2 C T 11: 78,054,805 T2M probably damaging Het
Herc1 T C 9: 66,486,124 L4095S probably damaging Het
Kcnh7 T C 2: 62,777,395 Y614C probably damaging Het
Lcp1 T A 14: 75,229,302 F616L possibly damaging Het
Myh15 T A 16: 49,096,519 Y401N probably damaging Het
Neb T C 2: 52,167,645 Y6144C probably damaging Het
Nr1h5 A G 3: 102,947,862 F308L probably damaging Het
Ntn5 G T 7: 45,692,382 V309L possibly damaging Het
Olfr1053 A T 2: 86,315,133 L51Q probably damaging Het
Olfr612 T A 7: 103,539,067 T56S probably benign Het
Pex1 G A 5: 3,606,411 probably null Het
Pld1 A T 3: 28,049,286 D380V probably damaging Het
Ptchd3 T C 11: 121,831,261 probably null Het
Rnf17 C T 14: 56,467,706 T689I probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Twf1 A T 15: 94,586,358 H94Q probably benign Het
Vmn2r13 T G 5: 109,174,202 I210L probably damaging Het
Zbtb49 T C 5: 38,213,331 E402G probably damaging Het
Other mutations in Prdm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Prdm1 APN 10 44441892 missense probably damaging 1.00
IGL01331:Prdm1 APN 10 44441974 missense possibly damaging 0.67
IGL02064:Prdm1 APN 10 44441342 missense probably damaging 1.00
IGL02669:Prdm1 APN 10 44439884 missense probably benign 0.28
IGL02944:Prdm1 APN 10 44441811 missense probably benign
IGL03295:Prdm1 APN 10 44439870 missense probably damaging 0.99
PIT4576001:Prdm1 UTSW 10 44458508 start codon destroyed probably null 0.05
R0008:Prdm1 UTSW 10 44441679 missense probably damaging 1.00
R0166:Prdm1 UTSW 10 44440091 missense probably damaging 1.00
R0226:Prdm1 UTSW 10 44456696 missense probably benign 0.03
R0284:Prdm1 UTSW 10 44456626 missense probably damaging 1.00
R0398:Prdm1 UTSW 10 44439809 missense probably damaging 1.00
R1405:Prdm1 UTSW 10 44439965 missense probably damaging 1.00
R1405:Prdm1 UTSW 10 44439965 missense probably damaging 1.00
R1438:Prdm1 UTSW 10 44442128 missense probably benign 0.00
R1519:Prdm1 UTSW 10 44439986 nonsense probably null
R1886:Prdm1 UTSW 10 44439758 missense probably damaging 0.99
R2070:Prdm1 UTSW 10 44441412 missense possibly damaging 0.82
R2508:Prdm1 UTSW 10 44446807 missense probably benign 0.37
R3087:Prdm1 UTSW 10 44446827 missense probably damaging 1.00
R3150:Prdm1 UTSW 10 44458492 unclassified probably null
R4165:Prdm1 UTSW 10 44441576 missense probably benign 0.11
R4490:Prdm1 UTSW 10 44446907 nonsense probably null
R4647:Prdm1 UTSW 10 44439690 missense probably damaging 0.98
R4911:Prdm1 UTSW 10 44442052 missense possibly damaging 0.90
R4925:Prdm1 UTSW 10 44440169 missense probably damaging 1.00
R5153:Prdm1 UTSW 10 44450225 missense possibly damaging 0.94
R5247:Prdm1 UTSW 10 44440102 missense probably damaging 1.00
R5792:Prdm1 UTSW 10 44450228 missense probably damaging 1.00
R6164:Prdm1 UTSW 10 44450195 missense probably damaging 1.00
R6247:Prdm1 UTSW 10 44446786 splice site probably null
R7196:Prdm1 UTSW 10 44456992 missense probably benign 0.14
R7270:Prdm1 UTSW 10 44441570 missense probably benign 0.07
Z1088:Prdm1 UTSW 10 44441925 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCGGCAAACTGTTTCCTTCCC -3'
(R):5'- ACTGTCACGAAGCTTACGGCTAAC -3'

Sequencing Primer
(F):5'- TGAGATTCACAGGTAGTCCACATC -3'
(R):5'- ATACCGAAGGGAACACGCTT -3'
Posted On2014-01-15