Incidental Mutation 'R1200:Flot2'
ID101309
Institutional Source Beutler Lab
Gene Symbol Flot2
Ensembl Gene ENSMUSG00000061981
Gene Nameflotillin 2
SynonymsEsa, reggie-2
MMRRC Submission 039270-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.241) question?
Stock #R1200 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location78037931-78060434 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 78054805 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 2 (T2M)
Ref Sequence ENSEMBL: ENSMUSP00000098347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072289] [ENSMUST00000073660] [ENSMUST00000100784] [ENSMUST00000148162]
Predicted Effect probably damaging
Transcript: ENSMUST00000072289
AA Change: T51M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072136
Gene: ENSMUSG00000061981
AA Change: T51M

DomainStartEndE-ValueType
PHB 87 269 1.34e-10 SMART
Pfam:Flot 311 422 6.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073660
SMART Domains Protein: ENSMUSP00000073342
Gene: ENSMUSG00000061981

DomainStartEndE-ValueType
PHB 87 269 1.34e-10 SMART
Pfam:Flot 311 422 5.1e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100784
AA Change: T2M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098347
Gene: ENSMUSG00000061981
AA Change: T2M

DomainStartEndE-ValueType
PHB 38 220 1.34e-10 SMART
Blast:PHB 277 347 2e-35 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136353
Predicted Effect silent
Transcript: ENSMUST00000148162
SMART Domains Protein: ENSMUSP00000133147
Gene: ENSMUSG00000061981

DomainStartEndE-ValueType
Blast:PHB 2 74 2e-34 BLAST
PDB:1WIN|A 40 74 2e-8 PDB
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Caveolae are small domains on the inner cell membrane involved in vesicular trafficking and signal transduction. This gene encodes a caveolae-associated, integral membrane protein, which is thought to function in neuronal signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced metastase into the lungs in a breast cancer model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
Abcc2 A T 19: 43,833,987 Q1421H probably damaging Het
Acat1 T A 9: 53,583,510 I361F possibly damaging Het
Akp3 T A 1: 87,125,260 I57N probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Axin2 C A 11: 108,931,550 D309E probably damaging Het
Clstn3 G T 6: 124,459,170 P207T probably damaging Het
Dip2b C A 15: 100,209,745 A1212E probably benign Het
Dnah5 A G 15: 28,246,257 I580M possibly damaging Het
Dpp3 T C 19: 4,923,129 T146A probably benign Het
Fam227a A G 15: 79,612,537 F613S possibly damaging Het
Fam83b T C 9: 76,492,312 D503G probably damaging Het
Herc1 T C 9: 66,486,124 L4095S probably damaging Het
Kcnh7 T C 2: 62,777,395 Y614C probably damaging Het
Lcp1 T A 14: 75,229,302 F616L possibly damaging Het
Myh15 T A 16: 49,096,519 Y401N probably damaging Het
Neb T C 2: 52,167,645 Y6144C probably damaging Het
Nr1h5 A G 3: 102,947,862 F308L probably damaging Het
Ntn5 G T 7: 45,692,382 V309L possibly damaging Het
Olfr1053 A T 2: 86,315,133 L51Q probably damaging Het
Olfr612 T A 7: 103,539,067 T56S probably benign Het
Pex1 G A 5: 3,606,411 probably null Het
Pld1 A T 3: 28,049,286 D380V probably damaging Het
Prdm1 A G 10: 44,450,130 Y148H probably damaging Het
Ptchd3 T C 11: 121,831,261 probably null Het
Rnf17 C T 14: 56,467,706 T689I probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Twf1 A T 15: 94,586,358 H94Q probably benign Het
Vmn2r13 T G 5: 109,174,202 I210L probably damaging Het
Zbtb49 T C 5: 38,213,331 E402G probably damaging Het
Other mutations in Flot2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01137:Flot2 APN 11 78049507 missense probably damaging 1.00
IGL02965:Flot2 APN 11 78059205 missense possibly damaging 0.50
PIT4382001:Flot2 UTSW 11 78053367 missense possibly damaging 0.85
R0330:Flot2 UTSW 11 78058958 missense possibly damaging 0.94
R1700:Flot2 UTSW 11 78049547 missense possibly damaging 0.88
R1701:Flot2 UTSW 11 78049547 missense possibly damaging 0.88
R1735:Flot2 UTSW 11 78058005 missense probably benign 0.05
R1992:Flot2 UTSW 11 78058619 missense probably damaging 0.97
R4812:Flot2 UTSW 11 78053365 missense probably damaging 0.99
R4840:Flot2 UTSW 11 78057513 missense probably damaging 1.00
R4927:Flot2 UTSW 11 78059062 missense probably damaging 0.98
R5396:Flot2 UTSW 11 78049488 nonsense probably null
R6865:Flot2 UTSW 11 78049492 missense probably benign 0.05
R7085:Flot2 UTSW 11 78058074 missense possibly damaging 0.94
R7262:Flot2 UTSW 11 78057349 missense probably damaging 0.99
R7286:Flot2 UTSW 11 78054786 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CGGTTCAAGCCAGGATGATGAACAG -3'
(R):5'- GGGCCAAGTGGTCATGTTCCAATG -3'

Sequencing Primer
(F):5'- TAGAGCCACCTGCTCCTAC -3'
(R):5'- GTTCCAATGATGATGATCCTGC -3'
Posted On2014-01-15