Incidental Mutation 'R1200:Axin2'
ID101311
Institutional Source Beutler Lab
Gene Symbol Axin2
Ensembl Gene ENSMUSG00000000142
Gene Nameaxin 2
SynonymsAxil, Conductin
MMRRC Submission 039270-MU
Accession Numbers

Genbank: NM_015732; MGI: 1270862

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1200 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location108920349-108950783 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 108931550 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 309 (D309E)
Ref Sequence ENSEMBL: ENSMUSP00000102322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052915] [ENSMUST00000106711]
Predicted Effect probably damaging
Transcript: ENSMUST00000052915
AA Change: D309E

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000051331
Gene: ENSMUSG00000000142
AA Change: D309E

DomainStartEndE-ValueType
Pfam:AXIN1_TNKS_BD 9 73 8.1e-27 PFAM
RGS 81 200 4.7e-33 SMART
low complexity region 302 318 N/A INTRINSIC
coiled coil region 377 405 N/A INTRINSIC
Pfam:Axin_b-cat_bind 432 472 7.6e-13 PFAM
low complexity region 511 520 N/A INTRINSIC
DAX 758 840 1.42e-47 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106711
AA Change: D309E

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102322
Gene: ENSMUSG00000000142
AA Change: D309E

DomainStartEndE-ValueType
low complexity region 22 35 N/A INTRINSIC
RGS 81 200 4.7e-33 SMART
low complexity region 302 318 N/A INTRINSIC
coiled coil region 377 405 N/A INTRINSIC
Pfam:Axin_b-cat_bind 432 469 8.6e-22 PFAM
low complexity region 511 520 N/A INTRINSIC
DAX 693 775 1.42e-47 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Axin-related protein, Axin2, presumably plays an important role in the regulation of the stability of beta-catenin in the Wnt signaling pathway, like its rodent homologs, mouse conductin/rat axil. In mouse, conductin organizes a multiprotein complex of APC (adenomatous polyposis of the colon), beta-catenin, glycogen synthase kinase 3-beta, and conductin, which leads to the degradation of beta-catenin. Apparently, the deregulation of beta-catenin is an important event in the genesis of a number of malignancies. The AXIN2 gene has been mapped to 17q23-q24, a region that shows frequent loss of heterozygosity in breast cancer, neuroblastoma, and other tumors. Mutations in this gene have been associated with colorectal cancer with defective mismatch repair. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit premature fusion of cranial sutures, enhanced expansion of osteoprogenitors, accelerated ossification, and increased osteoblast proliferation and differentiation. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
Abcc2 A T 19: 43,833,987 Q1421H probably damaging Het
Acat1 T A 9: 53,583,510 I361F possibly damaging Het
Akp3 T A 1: 87,125,260 I57N probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Clstn3 G T 6: 124,459,170 P207T probably damaging Het
Dip2b C A 15: 100,209,745 A1212E probably benign Het
Dnah5 A G 15: 28,246,257 I580M possibly damaging Het
Dpp3 T C 19: 4,923,129 T146A probably benign Het
Fam227a A G 15: 79,612,537 F613S possibly damaging Het
Fam83b T C 9: 76,492,312 D503G probably damaging Het
Flot2 C T 11: 78,054,805 T2M probably damaging Het
Herc1 T C 9: 66,486,124 L4095S probably damaging Het
Kcnh7 T C 2: 62,777,395 Y614C probably damaging Het
Lcp1 T A 14: 75,229,302 F616L possibly damaging Het
Myh15 T A 16: 49,096,519 Y401N probably damaging Het
Neb T C 2: 52,167,645 Y6144C probably damaging Het
Nr1h5 A G 3: 102,947,862 F308L probably damaging Het
Ntn5 G T 7: 45,692,382 V309L possibly damaging Het
Olfr1053 A T 2: 86,315,133 L51Q probably damaging Het
Olfr612 T A 7: 103,539,067 T56S probably benign Het
Pex1 G A 5: 3,606,411 probably null Het
Pld1 A T 3: 28,049,286 D380V probably damaging Het
Prdm1 A G 10: 44,450,130 Y148H probably damaging Het
Ptchd3 T C 11: 121,831,261 probably null Het
Rnf17 C T 14: 56,467,706 T689I probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Twf1 A T 15: 94,586,358 H94Q probably benign Het
Vmn2r13 T G 5: 109,174,202 I210L probably damaging Het
Zbtb49 T C 5: 38,213,331 E402G probably damaging Het
Other mutations in Axin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Axin2 APN 11 108923990 missense probably benign
IGL01094:Axin2 APN 11 108923675 missense probably damaging 0.99
IGL01563:Axin2 APN 11 108923805 missense probably damaging 0.97
IGL02088:Axin2 APN 11 108923616 missense probably damaging 1.00
IGL02724:Axin2 APN 11 108942946 missense possibly damaging 0.48
PIT4131001:Axin2 UTSW 11 108924003 missense possibly damaging 0.85
R0029:Axin2 UTSW 11 108924047 missense probably benign 0.01
R0052:Axin2 UTSW 11 108949270 missense probably damaging 1.00
R0112:Axin2 UTSW 11 108939397 missense possibly damaging 0.62
R0372:Axin2 UTSW 11 108923333 missense probably damaging 1.00
R0372:Axin2 UTSW 11 108924110 unclassified probably benign
R1924:Axin2 UTSW 11 108942968 missense probably benign 0.02
R2025:Axin2 UTSW 11 108943078 missense probably damaging 1.00
R2427:Axin2 UTSW 11 108923974 missense possibly damaging 0.93
R4210:Axin2 UTSW 11 108942576 missense possibly damaging 0.89
R4781:Axin2 UTSW 11 108943856 missense probably damaging 1.00
R4846:Axin2 UTSW 11 108942299 missense probably benign 0.00
R4956:Axin2 UTSW 11 108943078 missense probably damaging 1.00
X0054:Axin2 UTSW 11 108923574 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCACGTTGGCATAGGCCAGATG -3'
(R):5'- GTTTCCTTCCATGAAGACACCACCC -3'

Sequencing Primer
(F):5'- AACATCATTCTGGGGGTCAC -3'
(R):5'- ATGTGCTCTGAGAAGTGGGT -3'
Posted On2014-01-15