Incidental Mutation 'R1200:Ptchd3'
ID101313
Institutional Source Beutler Lab
Gene Symbol Ptchd3
Ensembl Gene ENSMUSG00000039198
Gene Namepatched domain containing 3
Synonyms4933440L20Rik, 4930451E13Rik
MMRRC Submission 039270-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1200 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location121830247-121843423 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 121831261 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000035709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036690]
Predicted Effect probably null
Transcript: ENSMUST00000036690
SMART Domains Protein: ENSMUSP00000035709
Gene: ENSMUSG00000039198

DomainStartEndE-ValueType
Pfam:Patched 121 906 1.2e-177 PFAM
Pfam:Sterol-sensing 363 508 3.4e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125199
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126556
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
Abcc2 A T 19: 43,833,987 Q1421H probably damaging Het
Acat1 T A 9: 53,583,510 I361F possibly damaging Het
Akp3 T A 1: 87,125,260 I57N probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Axin2 C A 11: 108,931,550 D309E probably damaging Het
Clstn3 G T 6: 124,459,170 P207T probably damaging Het
Dip2b C A 15: 100,209,745 A1212E probably benign Het
Dnah5 A G 15: 28,246,257 I580M possibly damaging Het
Dpp3 T C 19: 4,923,129 T146A probably benign Het
Fam227a A G 15: 79,612,537 F613S possibly damaging Het
Fam83b T C 9: 76,492,312 D503G probably damaging Het
Flot2 C T 11: 78,054,805 T2M probably damaging Het
Herc1 T C 9: 66,486,124 L4095S probably damaging Het
Kcnh7 T C 2: 62,777,395 Y614C probably damaging Het
Lcp1 T A 14: 75,229,302 F616L possibly damaging Het
Myh15 T A 16: 49,096,519 Y401N probably damaging Het
Neb T C 2: 52,167,645 Y6144C probably damaging Het
Nr1h5 A G 3: 102,947,862 F308L probably damaging Het
Ntn5 G T 7: 45,692,382 V309L possibly damaging Het
Olfr1053 A T 2: 86,315,133 L51Q probably damaging Het
Olfr612 T A 7: 103,539,067 T56S probably benign Het
Pex1 G A 5: 3,606,411 probably null Het
Pld1 A T 3: 28,049,286 D380V probably damaging Het
Prdm1 A G 10: 44,450,130 Y148H probably damaging Het
Rnf17 C T 14: 56,467,706 T689I probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Twf1 A T 15: 94,586,358 H94Q probably benign Het
Vmn2r13 T G 5: 109,174,202 I210L probably damaging Het
Zbtb49 T C 5: 38,213,331 E402G probably damaging Het
Other mutations in Ptchd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Ptchd3 APN 11 121831146 missense probably damaging 1.00
IGL01459:Ptchd3 APN 11 121830420 missense probably benign 0.00
IGL02815:Ptchd3 APN 11 121841604 missense probably benign 0.03
PIT4418001:Ptchd3 UTSW 11 121841740 nonsense probably null
PIT4791001:Ptchd3 UTSW 11 121832049 missense probably damaging 0.98
R0018:Ptchd3 UTSW 11 121842344 missense probably benign
R0068:Ptchd3 UTSW 11 121842972 missense probably damaging 1.00
R0068:Ptchd3 UTSW 11 121842972 missense probably damaging 1.00
R0316:Ptchd3 UTSW 11 121842090 missense possibly damaging 0.91
R0331:Ptchd3 UTSW 11 121842191 missense probably benign 0.00
R0715:Ptchd3 UTSW 11 121831158 missense possibly damaging 0.90
R1595:Ptchd3 UTSW 11 121830594 missense probably damaging 1.00
R1763:Ptchd3 UTSW 11 121842542 missense probably benign 0.00
R1792:Ptchd3 UTSW 11 121841551 nonsense probably null
R2098:Ptchd3 UTSW 11 121842479 missense probably damaging 1.00
R4120:Ptchd3 UTSW 11 121830746 missense probably damaging 1.00
R4533:Ptchd3 UTSW 11 121836431 missense probably damaging 1.00
R4702:Ptchd3 UTSW 11 121836409 missense probably damaging 1.00
R4761:Ptchd3 UTSW 11 121836398 missense possibly damaging 0.95
R4868:Ptchd3 UTSW 11 121831057 missense possibly damaging 0.85
R4948:Ptchd3 UTSW 11 121842516 missense probably damaging 1.00
R5092:Ptchd3 UTSW 11 121831146 missense probably damaging 1.00
R5954:Ptchd3 UTSW 11 121836587 intron probably benign
R6199:Ptchd3 UTSW 11 121831082 missense probably benign 0.17
R6431:Ptchd3 UTSW 11 121836403 missense probably benign 0.06
R6484:Ptchd3 UTSW 11 121842938 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GCATAACTCGTCGTTGAACCTGTCG -3'
(R):5'- GGGATTGCTGGCCCAGAGATTTATC -3'

Sequencing Primer
(F):5'- CAGCTCATCTACTTAGCGGG -3'
(R):5'- GGCCCAGAGATTTATCAGACAATATG -3'
Posted On2014-01-15