Incidental Mutation 'R1200:Lcp1'
ID101319
Institutional Source Beutler Lab
Gene Symbol Lcp1
Ensembl Gene ENSMUSG00000021998
Gene Namelymphocyte cytosolic protein 1
SynonymsD14Ertd310e, L-fimbrin, Pls2, L-plastin
MMRRC Submission 039270-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1200 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location75131101-75230842 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75229302 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 616 (F616L)
Ref Sequence ENSEMBL: ENSMUSP00000116271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124499] [ENSMUST00000131802] [ENSMUST00000145303]
Predicted Effect possibly damaging
Transcript: ENSMUST00000124499
AA Change: F616L

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000121201
Gene: ENSMUSG00000021998
AA Change: F616L

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
CH 122 234 1.15e-24 SMART
CH 266 373 1.51e-19 SMART
CH 396 501 1.87e-24 SMART
CH 517 622 8.55e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000131802
AA Change: F616L

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000117137
Gene: ENSMUSG00000021998
AA Change: F616L

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
CH 122 234 1.15e-24 SMART
CH 266 373 1.51e-19 SMART
CH 396 501 1.87e-24 SMART
CH 517 622 8.55e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000145303
AA Change: F616L

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000116271
Gene: ENSMUSG00000021998
AA Change: F616L

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
CH 122 234 1.15e-24 SMART
CH 266 373 1.51e-19 SMART
CH 396 501 1.87e-24 SMART
CH 517 622 8.55e-19 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. Plastin 1 (otherwise known as Fimbrin) is a third distinct plastin isoform which is specifically expressed at high levels in the small intestine. The L isoform is expressed only in hemopoietic cell lineages, while the T isoform has been found in all other normal cells of solid tissues that have replicative potential (fibroblasts, endothelial cells, epithelial cells, melanocytes, etc.). However, L-plastin has been found in many types of malignant human cells of non-hemopoietic origin suggesting that its expression is induced accompanying tumorigenesis in solid tissues. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to S. aureus infection, defective neutrophil killing of S. aureus, and impaired adhesion-dependent respiratory bursts in neutrophils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
Abcc2 A T 19: 43,833,987 Q1421H probably damaging Het
Acat1 T A 9: 53,583,510 I361F possibly damaging Het
Akp3 T A 1: 87,125,260 I57N probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Axin2 C A 11: 108,931,550 D309E probably damaging Het
Clstn3 G T 6: 124,459,170 P207T probably damaging Het
Dip2b C A 15: 100,209,745 A1212E probably benign Het
Dnah5 A G 15: 28,246,257 I580M possibly damaging Het
Dpp3 T C 19: 4,923,129 T146A probably benign Het
Fam227a A G 15: 79,612,537 F613S possibly damaging Het
Fam83b T C 9: 76,492,312 D503G probably damaging Het
Flot2 C T 11: 78,054,805 T2M probably damaging Het
Herc1 T C 9: 66,486,124 L4095S probably damaging Het
Kcnh7 T C 2: 62,777,395 Y614C probably damaging Het
Myh15 T A 16: 49,096,519 Y401N probably damaging Het
Neb T C 2: 52,167,645 Y6144C probably damaging Het
Nr1h5 A G 3: 102,947,862 F308L probably damaging Het
Ntn5 G T 7: 45,692,382 V309L possibly damaging Het
Olfr1053 A T 2: 86,315,133 L51Q probably damaging Het
Olfr612 T A 7: 103,539,067 T56S probably benign Het
Pex1 G A 5: 3,606,411 probably null Het
Pld1 A T 3: 28,049,286 D380V probably damaging Het
Prdm1 A G 10: 44,450,130 Y148H probably damaging Het
Ptchd3 T C 11: 121,831,261 probably null Het
Rnf17 C T 14: 56,467,706 T689I probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Twf1 A T 15: 94,586,358 H94Q probably benign Het
Vmn2r13 T G 5: 109,174,202 I210L probably damaging Het
Zbtb49 T C 5: 38,213,331 E402G probably damaging Het
Other mutations in Lcp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Lcp1 APN 14 75227093 critical splice donor site probably null
IGL01768:Lcp1 APN 14 75224133 missense probably benign 0.40
IGL01801:Lcp1 APN 14 75199375 missense probably benign 0.10
IGL01940:Lcp1 APN 14 75216365 missense probably benign 0.17
IGL02135:Lcp1 APN 14 75200486 missense probably benign 0.00
IGL02185:Lcp1 APN 14 75229300 missense possibly damaging 0.73
IGL02478:Lcp1 APN 14 75224096 missense probably benign 0.04
IGL02604:Lcp1 APN 14 75224126 missense probably benign 0.11
R0244:Lcp1 UTSW 14 75227001 missense possibly damaging 0.92
R0295:Lcp1 UTSW 14 75199420 missense probably null 0.59
R0313:Lcp1 UTSW 14 75199433 missense probably damaging 1.00
R0415:Lcp1 UTSW 14 75227006 missense possibly damaging 0.88
R0751:Lcp1 UTSW 14 75199387 missense probably benign 0.00
R0811:Lcp1 UTSW 14 75214488 missense probably benign 0.00
R0812:Lcp1 UTSW 14 75214488 missense probably benign 0.00
R1713:Lcp1 UTSW 14 75199444 critical splice donor site probably null
R1915:Lcp1 UTSW 14 75199297 missense possibly damaging 0.81
R1969:Lcp1 UTSW 14 75200506 missense probably damaging 1.00
R1970:Lcp1 UTSW 14 75200506 missense probably damaging 1.00
R1971:Lcp1 UTSW 14 75200506 missense probably damaging 1.00
R2045:Lcp1 UTSW 14 75200401 missense probably benign 0.01
R2064:Lcp1 UTSW 14 75198075 critical splice acceptor site probably null
R3949:Lcp1 UTSW 14 75206129 missense possibly damaging 0.68
R4062:Lcp1 UTSW 14 75215180 missense probably damaging 1.00
R4521:Lcp1 UTSW 14 75215168 missense possibly damaging 0.94
R4811:Lcp1 UTSW 14 75200408 missense probably damaging 0.99
R4854:Lcp1 UTSW 14 75200489 missense probably damaging 1.00
R4974:Lcp1 UTSW 14 75208471 nonsense probably null
R5539:Lcp1 UTSW 14 75229298 missense probably benign 0.08
R5561:Lcp1 UTSW 14 75212508 missense probably benign 0.01
R5724:Lcp1 UTSW 14 75226982 missense probably benign 0.18
R5989:Lcp1 UTSW 14 75199387 missense probably benign 0.00
R6731:Lcp1 UTSW 14 75206189 missense probably damaging 1.00
S24628:Lcp1 UTSW 14 75227006 missense possibly damaging 0.88
X0027:Lcp1 UTSW 14 75227086 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAAACACAGCCCACGGAGTG -3'
(R):5'- TCTGAACAAGGCCAAGAGCAGC -3'

Sequencing Primer
(F):5'- tgcctgcctcccaaacac -3'
(R):5'- TGAATGGTCCTCTGCATCCT -3'
Posted On2014-01-15