Incidental Mutation 'R1200:Fam227a'
ID101325
Institutional Source Beutler Lab
Gene Symbol Fam227a
Ensembl Gene ENSMUSG00000042564
Gene Namefamily with sequence similarity 227, member A
Synonyms4933432B09Rik
MMRRC Submission 039270-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R1200 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location79609576-79658956 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79612537 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 613 (F613S)
Ref Sequence ENSEMBL: ENSMUSP00000155261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109646] [ENSMUST00000109648] [ENSMUST00000187519] [ENSMUST00000191401] [ENSMUST00000229064]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109646
AA Change: F261S

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105273
Gene: ENSMUSG00000042564
AA Change: F261S

DomainStartEndE-ValueType
low complexity region 156 175 N/A INTRINSIC
low complexity region 204 211 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109648
AA Change: F617S

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105275
Gene: ENSMUSG00000042564
AA Change: F617S

DomainStartEndE-ValueType
Pfam:FWWh 134 295 1.4e-51 PFAM
low complexity region 512 531 N/A INTRINSIC
low complexity region 560 567 N/A INTRINSIC
low complexity region 599 609 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000187519
AA Change: F617S

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139524
Gene: ENSMUSG00000042564
AA Change: F617S

DomainStartEndE-ValueType
Pfam:FWWh 132 295 1e-47 PFAM
low complexity region 512 531 N/A INTRINSIC
low complexity region 560 567 N/A INTRINSIC
low complexity region 599 609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191401
Predicted Effect possibly damaging
Transcript: ENSMUST00000229064
AA Change: F613S

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
Abcc2 A T 19: 43,833,987 Q1421H probably damaging Het
Acat1 T A 9: 53,583,510 I361F possibly damaging Het
Akp3 T A 1: 87,125,260 I57N probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Axin2 C A 11: 108,931,550 D309E probably damaging Het
Clstn3 G T 6: 124,459,170 P207T probably damaging Het
Dip2b C A 15: 100,209,745 A1212E probably benign Het
Dnah5 A G 15: 28,246,257 I580M possibly damaging Het
Dpp3 T C 19: 4,923,129 T146A probably benign Het
Fam83b T C 9: 76,492,312 D503G probably damaging Het
Flot2 C T 11: 78,054,805 T2M probably damaging Het
Herc1 T C 9: 66,486,124 L4095S probably damaging Het
Kcnh7 T C 2: 62,777,395 Y614C probably damaging Het
Lcp1 T A 14: 75,229,302 F616L possibly damaging Het
Myh15 T A 16: 49,096,519 Y401N probably damaging Het
Neb T C 2: 52,167,645 Y6144C probably damaging Het
Nr1h5 A G 3: 102,947,862 F308L probably damaging Het
Ntn5 G T 7: 45,692,382 V309L possibly damaging Het
Olfr1053 A T 2: 86,315,133 L51Q probably damaging Het
Olfr612 T A 7: 103,539,067 T56S probably benign Het
Pex1 G A 5: 3,606,411 probably null Het
Pld1 A T 3: 28,049,286 D380V probably damaging Het
Prdm1 A G 10: 44,450,130 Y148H probably damaging Het
Ptchd3 T C 11: 121,831,261 probably null Het
Rnf17 C T 14: 56,467,706 T689I probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Twf1 A T 15: 94,586,358 H94Q probably benign Het
Vmn2r13 T G 5: 109,174,202 I210L probably damaging Het
Zbtb49 T C 5: 38,213,331 E402G probably damaging Het
Other mutations in Fam227a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01650:Fam227a APN 15 79634073 missense possibly damaging 0.66
IGL01807:Fam227a APN 15 79649655 missense probably benign 0.03
IGL01936:Fam227a APN 15 79612546 missense possibly damaging 0.90
IGL02355:Fam227a APN 15 79643938 intron probably benign
IGL02362:Fam227a APN 15 79643938 intron probably benign
IGL02569:Fam227a APN 15 79634122 missense probably benign
IGL02713:Fam227a APN 15 79636796 splice site probably benign
IGL02734:Fam227a APN 15 79617841 splice site probably benign
IGL02816:Fam227a APN 15 79626296 missense possibly damaging 0.66
IGL03354:Fam227a APN 15 79636750 missense possibly damaging 0.91
R0105:Fam227a UTSW 15 79620832 missense possibly damaging 0.90
R0194:Fam227a UTSW 15 79640669 nonsense probably null
R0437:Fam227a UTSW 15 79643988 missense possibly damaging 0.90
R0786:Fam227a UTSW 15 79626268 missense probably benign 0.01
R0925:Fam227a UTSW 15 79620805 missense probably benign 0.04
R1424:Fam227a UTSW 15 79634108 missense probably benign 0.34
R1474:Fam227a UTSW 15 79615381 missense probably damaging 0.97
R1495:Fam227a UTSW 15 79626245 missense probably benign 0.00
R1561:Fam227a UTSW 15 79636762 missense possibly damaging 0.95
R1661:Fam227a UTSW 15 79620677 intron probably null
R1669:Fam227a UTSW 15 79620677 intron probably null
R1967:Fam227a UTSW 15 79637134 missense possibly damaging 0.93
R1976:Fam227a UTSW 15 79626276 missense possibly damaging 0.83
R2197:Fam227a UTSW 15 79623467 missense probably damaging 0.97
R2230:Fam227a UTSW 15 79615381 missense possibly damaging 0.66
R2231:Fam227a UTSW 15 79615381 missense possibly damaging 0.66
R2232:Fam227a UTSW 15 79615381 missense possibly damaging 0.66
R2910:Fam227a UTSW 15 79636734 missense possibly damaging 0.81
R3027:Fam227a UTSW 15 79648733 splice site probably null
R3943:Fam227a UTSW 15 79620859 splice site probably benign
R4811:Fam227a UTSW 15 79615427 missense possibly damaging 0.66
R4845:Fam227a UTSW 15 79649711 missense probably damaging 0.99
R4896:Fam227a UTSW 15 79637054 missense probably benign 0.32
R4934:Fam227a UTSW 15 79637061 missense possibly damaging 0.71
R4941:Fam227a UTSW 15 79640003 critical splice donor site probably null
R5225:Fam227a UTSW 15 79636735 missense possibly damaging 0.90
R5369:Fam227a UTSW 15 79615436 missense probably benign 0.27
R5593:Fam227a UTSW 15 79640058 utr 3 prime probably benign
R6311:Fam227a UTSW 15 79640694 missense probably benign 0.23
R6362:Fam227a UTSW 15 79643350 missense possibly damaging 0.53
R6532:Fam227a UTSW 15 79636720 missense probably benign 0.00
R7239:Fam227a UTSW 15 79634062 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCAGCTCAGCTCCCTTCTGATAC -3'
(R):5'- GCAGTGAATACACTGTACCACACGC -3'

Sequencing Primer
(F):5'- gctCCCTTCTGATACGTGGTG -3'
(R):5'- ATACACTGTACCACACGCTCTTC -3'
Posted On2014-01-15