Incidental Mutation 'R1200:Twf1'
ID101327
Institutional Source Beutler Lab
Gene Symbol Twf1
Ensembl Gene ENSMUSG00000022451
Gene Nametwinfilin actin binding protein 1
Synonymsactin monomer-binding protein, A6, Twinfilin-1, Ptk9, twinfilin
MMRRC Submission 039270-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1200 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location94577951-94589889 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 94586358 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 94 (H94Q)
Ref Sequence ENSEMBL: ENSMUSP00000023087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023087] [ENSMUST00000109248] [ENSMUST00000152590]
PDB Structure
CRYSTAL STRUCTURE OF THE N-TERMINAL ADF-H DOMAIN OF MOUSE TWINFILIN ISOFORM-1 [X-RAY DIFFRACTION]
Solution structure of the second tandem cofilin-domain of mouse twinfilin [SOLUTION NMR]
Solution structure of C-teminal domain of twinfilin-1. [SOLUTION NMR]
Structure of the actin-depolymerizing factor homology domain in complex with actin [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000023087
AA Change: H94Q

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000023087
Gene: ENSMUSG00000022451
AA Change: H94Q

DomainStartEndE-ValueType
ADF 11 139 4.74e-35 SMART
ADF 184 313 6.22e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109248
SMART Domains Protein: ENSMUSP00000104871
Gene: ENSMUSG00000059883

DomainStartEndE-ValueType
Pfam:Death 20 101 1.6e-6 PFAM
Pfam:Pkinase_Tyr 187 452 1.9e-51 PFAM
Pfam:Pkinase 188 452 1.3e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127347
Predicted Effect probably benign
Transcript: ENSMUST00000152590
AA Change: H68Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119302
Gene: ENSMUSG00000022451
AA Change: H68Q

DomainStartEndE-ValueType
ADF 1 113 1.9e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155654
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes twinfilin, an actin monomer-binding protein conserved from yeast to mammals. Studies of the mouse counterpart suggest that this protein may be an actin monomer-binding protein, and its localization to cortical G-actin-rich structures may be regulated by the small GTPase RAC1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
Abcc2 A T 19: 43,833,987 Q1421H probably damaging Het
Acat1 T A 9: 53,583,510 I361F possibly damaging Het
Akp3 T A 1: 87,125,260 I57N probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Axin2 C A 11: 108,931,550 D309E probably damaging Het
Clstn3 G T 6: 124,459,170 P207T probably damaging Het
Dip2b C A 15: 100,209,745 A1212E probably benign Het
Dnah5 A G 15: 28,246,257 I580M possibly damaging Het
Dpp3 T C 19: 4,923,129 T146A probably benign Het
Fam227a A G 15: 79,612,537 F613S possibly damaging Het
Fam83b T C 9: 76,492,312 D503G probably damaging Het
Flot2 C T 11: 78,054,805 T2M probably damaging Het
Herc1 T C 9: 66,486,124 L4095S probably damaging Het
Kcnh7 T C 2: 62,777,395 Y614C probably damaging Het
Lcp1 T A 14: 75,229,302 F616L possibly damaging Het
Myh15 T A 16: 49,096,519 Y401N probably damaging Het
Neb T C 2: 52,167,645 Y6144C probably damaging Het
Nr1h5 A G 3: 102,947,862 F308L probably damaging Het
Ntn5 G T 7: 45,692,382 V309L possibly damaging Het
Olfr1053 A T 2: 86,315,133 L51Q probably damaging Het
Olfr612 T A 7: 103,539,067 T56S probably benign Het
Pex1 G A 5: 3,606,411 probably null Het
Pld1 A T 3: 28,049,286 D380V probably damaging Het
Prdm1 A G 10: 44,450,130 Y148H probably damaging Het
Ptchd3 T C 11: 121,831,261 probably null Het
Rnf17 C T 14: 56,467,706 T689I probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Vmn2r13 T G 5: 109,174,202 I210L probably damaging Het
Zbtb49 T C 5: 38,213,331 E402G probably damaging Het
Other mutations in Twf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Twf1 APN 15 94580936 unclassified probably benign
IGL02732:Twf1 APN 15 94581009 missense probably damaging 1.00
R0122:Twf1 UTSW 15 94586549 splice site probably benign
R0184:Twf1 UTSW 15 94581067 critical splice acceptor site probably null
R0507:Twf1 UTSW 15 94585530 missense probably damaging 1.00
R0742:Twf1 UTSW 15 94585530 missense probably damaging 1.00
R1858:Twf1 UTSW 15 94585547 splice site probably benign
R2005:Twf1 UTSW 15 94585447 critical splice donor site probably null
R2290:Twf1 UTSW 15 94586519 missense probably damaging 0.98
R3732:Twf1 UTSW 15 94584414 unclassified probably benign
R4787:Twf1 UTSW 15 94584434 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTGCTCGATTAGTGAGGAGCCG -3'
(R):5'- TCCGATACGACACTGCATTCATCTG -3'

Sequencing Primer
(F):5'- CTCAGGGGTCACGATTAATTAGC -3'
(R):5'- TCCTTTCATAGAGCAACTGGTG -3'
Posted On2014-01-15