Incidental Mutation 'R1200:4930562C15Rik'
ID101331
Institutional Source Beutler Lab
Gene Symbol 4930562C15Rik
Ensembl Gene ENSMUSG00000022518
Gene NameRIKEN cDNA 4930562C15 gene
Synonyms
MMRRC Submission 039270-MU
Accession Numbers

Ncbi RefSeq: NM_030192.1; MGI:1926059

Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R1200 (G1)
Quality Score132
Status Not validated
Chromosome16
Chromosomal Location4835416-4867686 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4849672 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 309 (F309S)
Ref Sequence ENSEMBL: ENSMUSP00000097784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100211] [ENSMUST00000175836] [ENSMUST00000177042]
Predicted Effect unknown
Transcript: ENSMUST00000100211
AA Change: F309S
SMART Domains Protein: ENSMUSP00000097784
Gene: ENSMUSG00000022518
AA Change: F309S

DomainStartEndE-ValueType
coiled coil region 74 101 N/A INTRINSIC
coiled coil region 181 211 N/A INTRINSIC
internal_repeat_1 289 315 2.54e-5 PROSPERO
internal_repeat_1 314 341 2.54e-5 PROSPERO
low complexity region 360 377 N/A INTRINSIC
low complexity region 402 424 N/A INTRINSIC
low complexity region 452 469 N/A INTRINSIC
low complexity region 573 604 N/A INTRINSIC
low complexity region 616 627 N/A INTRINSIC
low complexity region 630 647 N/A INTRINSIC
low complexity region 652 672 N/A INTRINSIC
Pfam:DUF4795 745 960 1.7e-46 PFAM
low complexity region 1095 1109 N/A INTRINSIC
low complexity region 1111 1125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175836
SMART Domains Protein: ENSMUSP00000135532
Gene: ENSMUSG00000022518

DomainStartEndE-ValueType
internal_repeat_1 72 98 1.04e-6 PROSPERO
internal_repeat_1 97 124 1.04e-6 PROSPERO
low complexity region 143 160 N/A INTRINSIC
low complexity region 185 207 N/A INTRINSIC
low complexity region 235 252 N/A INTRINSIC
internal_repeat_2 253 306 2.47e-5 PROSPERO
internal_repeat_2 297 351 2.47e-5 PROSPERO
low complexity region 356 387 N/A INTRINSIC
low complexity region 399 410 N/A INTRINSIC
low complexity region 413 430 N/A INTRINSIC
low complexity region 435 455 N/A INTRINSIC
coiled coil region 564 582 N/A INTRINSIC
low complexity region 590 601 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177042
SMART Domains Protein: ENSMUSP00000135160
Gene: ENSMUSG00000022518

DomainStartEndE-ValueType
coiled coil region 74 101 N/A INTRINSIC
coiled coil region 181 211 N/A INTRINSIC
internal_repeat_1 289 315 2.39e-6 PROSPERO
internal_repeat_1 314 341 2.39e-6 PROSPERO
low complexity region 360 377 N/A INTRINSIC
low complexity region 402 424 N/A INTRINSIC
low complexity region 452 469 N/A INTRINSIC
internal_repeat_2 470 523 5.51e-5 PROSPERO
internal_repeat_2 514 568 5.51e-5 PROSPERO
low complexity region 573 604 N/A INTRINSIC
low complexity region 616 627 N/A INTRINSIC
low complexity region 630 647 N/A INTRINSIC
low complexity region 652 672 N/A INTRINSIC
coiled coil region 781 799 N/A INTRINSIC
low complexity region 807 818 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,833,987 Q1421H probably damaging Het
Acat1 T A 9: 53,583,510 I361F possibly damaging Het
Akp3 T A 1: 87,125,260 I57N probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Axin2 C A 11: 108,931,550 D309E probably damaging Het
Clstn3 G T 6: 124,459,170 P207T probably damaging Het
Dip2b C A 15: 100,209,745 A1212E probably benign Het
Dnah5 A G 15: 28,246,257 I580M possibly damaging Het
Dpp3 T C 19: 4,923,129 T146A probably benign Het
Fam227a A G 15: 79,612,537 F613S possibly damaging Het
Fam83b T C 9: 76,492,312 D503G probably damaging Het
Flot2 C T 11: 78,054,805 T2M probably damaging Het
Herc1 T C 9: 66,486,124 L4095S probably damaging Het
Kcnh7 T C 2: 62,777,395 Y614C probably damaging Het
Lcp1 T A 14: 75,229,302 F616L possibly damaging Het
Myh15 T A 16: 49,096,519 Y401N probably damaging Het
Neb T C 2: 52,167,645 Y6144C probably damaging Het
Nr1h5 A G 3: 102,947,862 F308L probably damaging Het
Ntn5 G T 7: 45,692,382 V309L possibly damaging Het
Olfr1053 A T 2: 86,315,133 L51Q probably damaging Het
Olfr612 T A 7: 103,539,067 T56S probably benign Het
Pex1 G A 5: 3,606,411 probably null Het
Pld1 A T 3: 28,049,286 D380V probably damaging Het
Prdm1 A G 10: 44,450,130 Y148H probably damaging Het
Ptchd3 T C 11: 121,831,261 probably null Het
Rnf17 C T 14: 56,467,706 T689I probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Twf1 A T 15: 94,586,358 H94Q probably benign Het
Vmn2r13 T G 5: 109,174,202 I210L probably damaging Het
Zbtb49 T C 5: 38,213,331 E402G probably damaging Het
Other mutations in 4930562C15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00936:4930562C15Rik APN 16 4864646 missense probably benign 0.31
IGL01610:4930562C15Rik APN 16 4851565 splice site probably benign
IGL02869:4930562C15Rik APN 16 4867459 missense possibly damaging 0.68
IGL03242:4930562C15Rik APN 16 4849325 missense unknown
R0063:4930562C15Rik UTSW 16 4861048 nonsense probably null
R0063:4930562C15Rik UTSW 16 4861048 nonsense probably null
R0083:4930562C15Rik UTSW 16 4849542 missense unknown
R0565:4930562C15Rik UTSW 16 4864336 missense probably benign 0.22
R0630:4930562C15Rik UTSW 16 4850939 missense possibly damaging 0.90
R0734:4930562C15Rik UTSW 16 4850334 missense probably benign 0.01
R1738:4930562C15Rik UTSW 16 4864611 missense probably damaging 1.00
R1775:4930562C15Rik UTSW 16 4851558 unclassified probably null
R1945:4930562C15Rik UTSW 16 4835685 missense unknown
R2132:4930562C15Rik UTSW 16 4835971 missense unknown
R2445:4930562C15Rik UTSW 16 4864397 splice site probably null
R2696:4930562C15Rik UTSW 16 4850364 missense probably benign 0.04
R4729:4930562C15Rik UTSW 16 4849323 missense unknown
R4779:4930562C15Rik UTSW 16 4849749 missense unknown
R4806:4930562C15Rik UTSW 16 4849672 missense unknown
R4808:4930562C15Rik UTSW 16 4849672 missense unknown
R4876:4930562C15Rik UTSW 16 4849672 missense unknown
R4931:4930562C15Rik UTSW 16 4861046 missense possibly damaging 0.47
R4956:4930562C15Rik UTSW 16 4854952 missense probably damaging 0.99
R5085:4930562C15Rik UTSW 16 4835973 nonsense probably null
R5203:4930562C15Rik UTSW 16 4835598 missense unknown
R5229:4930562C15Rik UTSW 16 4850051 missense possibly damaging 0.73
R5461:4930562C15Rik UTSW 16 4864363 missense probably damaging 1.00
R5462:4930562C15Rik UTSW 16 4864363 missense probably damaging 1.00
R5464:4930562C15Rik UTSW 16 4864363 missense probably damaging 1.00
R5595:4930562C15Rik UTSW 16 4864279 missense probably benign 0.01
R6054:4930562C15Rik UTSW 16 4835865 missense unknown
R6405:4930562C15Rik UTSW 16 4851878 missense probably damaging 0.97
R6859:4930562C15Rik UTSW 16 4851935 missense possibly damaging 0.86
R7124:4930562C15Rik UTSW 16 4864332 missense probably benign 0.02
R7139:4930562C15Rik UTSW 16 4850184 missense probably benign 0.00
R7182:4930562C15Rik UTSW 16 4849714 missense unknown
R7219:4930562C15Rik UTSW 16 4849644 missense unknown
X0028:4930562C15Rik UTSW 16 4867367 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TTCAGTCCGGTGAGCGGAAAAG -3'
(R):5'- AGGCCAATAGTTACCCCTAGCCAAG -3'

Sequencing Primer
(F):5'- AGAGCATGGTCTCTCTGCC -3'
(R):5'- TAGCCAAGCCTCTTGGTAAG -3'
Posted On2014-01-15