Incidental Mutation 'R1200:Dpp3'
ID101337
Institutional Source Beutler Lab
Gene Symbol Dpp3
Ensembl Gene ENSMUSG00000063904
Gene Namedipeptidylpeptidase 3
Synonyms4930533O14Rik
MMRRC Submission 039270-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.431) question?
Stock #R1200 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location4907229-4928287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4923129 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 146 (T146A)
Ref Sequence ENSEMBL: ENSMUSP00000025851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025851]
Predicted Effect probably benign
Transcript: ENSMUST00000025851
AA Change: T146A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025851
Gene: ENSMUSG00000063904
AA Change: T146A

DomainStartEndE-ValueType
Pfam:Peptidase_M49 143 704 1.3e-236 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the M49 family of metallopeptidases. This cytoplasmic protein binds a single zinc ion with its zinc-binding motif (HELLGH) and has post-proline dipeptidyl aminopeptidase activity, cleaving Xaa-Pro dipeptides from the N-termini of proteins. Increased activity of this protein is associated with endometrial and ovarian cancers. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
Abcc2 A T 19: 43,833,987 Q1421H probably damaging Het
Acat1 T A 9: 53,583,510 I361F possibly damaging Het
Akp3 T A 1: 87,125,260 I57N probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Axin2 C A 11: 108,931,550 D309E probably damaging Het
Clstn3 G T 6: 124,459,170 P207T probably damaging Het
Dip2b C A 15: 100,209,745 A1212E probably benign Het
Dnah5 A G 15: 28,246,257 I580M possibly damaging Het
Fam227a A G 15: 79,612,537 F613S possibly damaging Het
Fam83b T C 9: 76,492,312 D503G probably damaging Het
Flot2 C T 11: 78,054,805 T2M probably damaging Het
Herc1 T C 9: 66,486,124 L4095S probably damaging Het
Kcnh7 T C 2: 62,777,395 Y614C probably damaging Het
Lcp1 T A 14: 75,229,302 F616L possibly damaging Het
Myh15 T A 16: 49,096,519 Y401N probably damaging Het
Neb T C 2: 52,167,645 Y6144C probably damaging Het
Nr1h5 A G 3: 102,947,862 F308L probably damaging Het
Ntn5 G T 7: 45,692,382 V309L possibly damaging Het
Olfr1053 A T 2: 86,315,133 L51Q probably damaging Het
Olfr612 T A 7: 103,539,067 T56S probably benign Het
Pex1 G A 5: 3,606,411 probably null Het
Pld1 A T 3: 28,049,286 D380V probably damaging Het
Prdm1 A G 10: 44,450,130 Y148H probably damaging Het
Ptchd3 T C 11: 121,831,261 probably null Het
Rnf17 C T 14: 56,467,706 T689I probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Twf1 A T 15: 94,586,358 H94Q probably benign Het
Vmn2r13 T G 5: 109,174,202 I210L probably damaging Het
Zbtb49 T C 5: 38,213,331 E402G probably damaging Het
Other mutations in Dpp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01487:Dpp3 APN 19 4913892 missense probably benign 0.00
IGL01657:Dpp3 APN 19 4918304 missense possibly damaging 0.72
IGL02105:Dpp3 APN 19 4916771 missense probably damaging 1.00
IGL02251:Dpp3 APN 19 4918315 missense probably benign
IGL02669:Dpp3 APN 19 4923682 critical splice donor site probably null
IGL02739:Dpp3 APN 19 4923728 missense probably damaging 1.00
IGL02851:Dpp3 APN 19 4923131 missense probably benign 0.06
R0046:Dpp3 UTSW 19 4914643 missense probably damaging 0.99
R0046:Dpp3 UTSW 19 4914643 missense probably damaging 0.99
R0053:Dpp3 UTSW 19 4923126 missense probably damaging 0.99
R0505:Dpp3 UTSW 19 4914654 missense probably damaging 1.00
R0681:Dpp3 UTSW 19 4914654 missense probably damaging 1.00
R1163:Dpp3 UTSW 19 4914923 nonsense probably null
R1761:Dpp3 UTSW 19 4921149 missense probably benign 0.37
R1931:Dpp3 UTSW 19 4917860 splice site probably benign
R2255:Dpp3 UTSW 19 4918319 missense probably benign
R2424:Dpp3 UTSW 19 4907707 nonsense probably null
R3718:Dpp3 UTSW 19 4923065 critical splice donor site probably null
R3727:Dpp3 UTSW 19 4923185 missense probably benign 0.30
R5080:Dpp3 UTSW 19 4915080 missense probably benign 0.00
R5587:Dpp3 UTSW 19 4918267 missense probably damaging 0.98
R5786:Dpp3 UTSW 19 4918322 missense possibly damaging 0.53
R5986:Dpp3 UTSW 19 4918357 missense probably benign 0.18
R6128:Dpp3 UTSW 19 4922392 missense probably benign 0.05
R6989:Dpp3 UTSW 19 4921167 missense probably damaging 1.00
R7019:Dpp3 UTSW 19 4916789 missense possibly damaging 0.83
R7070:Dpp3 UTSW 19 4918328 missense probably benign 0.24
R7100:Dpp3 UTSW 19 4918041 missense probably damaging 1.00
R7265:Dpp3 UTSW 19 4923769 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCAAGTGGCTTCAGTTCAAGAG -3'
(R):5'- GCAAAGTCCATGCACTGTCGTTCC -3'

Sequencing Primer
(F):5'- GGCTTCAGTTCAAGAGTAGGG -3'
(R):5'- gcttgctgctgctgctg -3'
Posted On2014-01-15