Incidental Mutation 'R1201:Zfp607a'
ID101373
Institutional Source Beutler Lab
Gene Symbol Zfp607a
Ensembl Gene ENSMUSG00000020420
Gene Namezinc finger protein 607A
SynonymsZfp607, 4732475C15Rik
MMRRC Submission 039271-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R1201 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location27857527-27880825 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 27879311 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 602 (F602Y)
Ref Sequence ENSEMBL: ENSMUSP00000146006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053722] [ENSMUST00000205534] [ENSMUST00000205715]
Predicted Effect probably damaging
Transcript: ENSMUST00000053722
AA Change: F602Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051496
Gene: ENSMUSG00000020420
AA Change: F602Y

DomainStartEndE-ValueType
KRAB 14 75 8.48e-36 SMART
ZnF_C2H2 173 195 2.91e-2 SMART
ZnF_C2H2 201 223 3.44e-4 SMART
ZnF_C2H2 229 251 3.83e-2 SMART
ZnF_C2H2 257 279 4.87e-4 SMART
ZnF_C2H2 285 307 1.38e-3 SMART
ZnF_C2H2 313 335 4.17e-3 SMART
ZnF_C2H2 341 363 2.86e-1 SMART
ZnF_C2H2 369 391 5.14e-3 SMART
ZnF_C2H2 397 419 1.2e-3 SMART
ZnF_C2H2 425 447 4.47e-3 SMART
ZnF_C2H2 453 475 1.1e-2 SMART
ZnF_C2H2 481 503 1.45e-2 SMART
ZnF_C2H2 509 531 1.12e-3 SMART
ZnF_C2H2 537 559 1.5e-4 SMART
ZnF_C2H2 565 587 8.34e-3 SMART
ZnF_C2H2 593 615 1.12e-3 SMART
ZnF_C2H2 621 643 6.42e-4 SMART
ZnF_C2H2 649 671 6.23e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000205534
AA Change: F602Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000205715
AA Change: F602Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206136
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,716,282 T103A possibly damaging Het
4932438A13Rik A G 3: 36,948,375 S1490G probably benign Het
Acly A G 11: 100,493,935 I674T probably damaging Het
Aco2 C T 15: 81,895,193 S33L probably damaging Het
Actc1 A G 2: 114,049,513 probably null Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Arhgap40 A C 2: 158,534,769 D275A probably damaging Het
Car11 A G 7: 45,703,480 D221G probably benign Het
Catsperg1 A T 7: 29,191,670 H596Q possibly damaging Het
Ccm2 T C 11: 6,593,682 V231A probably benign Het
Crh A G 3: 19,693,926 I184T probably damaging Het
Csgalnact2 A G 6: 118,114,432 S424P probably damaging Het
Dbf4 A C 5: 8,397,498 L571V possibly damaging Het
Fam105a G A 15: 27,658,173 Q84* probably null Het
Fancm A G 12: 65,106,768 K66E possibly damaging Het
Hydin T C 8: 110,569,855 V3672A probably benign Het
Kcnh2 C T 5: 24,322,672 R894H probably damaging Het
Krt36 T C 11: 100,104,057 N230D probably benign Het
Nlrp4b G T 7: 10,715,436 R522L possibly damaging Het
Ntn1 T C 11: 68,213,226 D532G probably damaging Het
Numb A T 12: 83,801,285 V215D probably damaging Het
Olfr1355 A T 10: 78,879,477 M102L probably benign Het
Olfr1415 T G 1: 92,491,153 I201L probably benign Het
Olfr175-ps1 A G 16: 58,823,863 I282T probably damaging Het
Olfr54 T A 11: 51,027,110 M36K probably damaging Het
Olfr727 T A 14: 50,127,356 W260R probably damaging Het
Pidd1 A G 7: 141,440,274 F580L probably benign Het
Plekhg4 A G 8: 105,381,673 D1116G probably damaging Het
Prss33 G T 17: 23,835,110 S74* probably null Het
Rab34 T A 11: 78,190,396 probably null Het
Rims2 A C 15: 39,616,324 T1251P possibly damaging Het
Skint5 A G 4: 113,556,145 S1152P unknown Het
Slc6a17 T A 3: 107,493,072 Q206L possibly damaging Het
Tmem59l C T 8: 70,484,387 W310* probably null Het
Tnrc6c T G 11: 117,721,674 N379K probably damaging Het
Vmn1r76 A C 7: 11,930,325 F286V probably benign Het
Xdh T C 17: 73,918,418 D463G probably benign Het
Zfp251 C T 15: 76,854,236 R219Q possibly damaging Het
Zfp263 T A 16: 3,749,430 H536Q probably damaging Het
Other mutations in Zfp607a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Zfp607a APN 7 27877789 missense possibly damaging 0.55
IGL01019:Zfp607a APN 7 27878617 missense probably damaging 1.00
IGL01412:Zfp607a APN 7 27878684 missense probably damaging 0.99
IGL03206:Zfp607a APN 7 27877823 missense possibly damaging 0.52
R0071:Zfp607a UTSW 7 27878269 missense probably damaging 0.96
R0304:Zfp607a UTSW 7 27879212 missense possibly damaging 0.92
R0685:Zfp607a UTSW 7 27878476 missense probably damaging 0.97
R0726:Zfp607a UTSW 7 27879149 missense probably benign 0.00
R1304:Zfp607a UTSW 7 27865575 missense probably benign 0.00
R1648:Zfp607a UTSW 7 27879068 missense probably benign 0.02
R1732:Zfp607a UTSW 7 27878459 missense probably damaging 1.00
R2194:Zfp607a UTSW 7 27879380 missense possibly damaging 0.73
R3793:Zfp607a UTSW 7 27878906 missense probably benign 0.01
R3808:Zfp607a UTSW 7 27879401 missense probably benign 0.01
R4296:Zfp607a UTSW 7 27865648 missense probably damaging 1.00
R4786:Zfp607a UTSW 7 27879413 missense probably damaging 1.00
R4792:Zfp607a UTSW 7 27878653 missense probably benign 0.23
R4915:Zfp607a UTSW 7 27878560 missense probably benign 0.00
R4950:Zfp607a UTSW 7 27878751 missense probably damaging 1.00
R5123:Zfp607a UTSW 7 27879098 missense probably damaging 1.00
R5217:Zfp607a UTSW 7 27877844 missense probably damaging 0.97
R5270:Zfp607a UTSW 7 27878305 nonsense probably null
R5403:Zfp607a UTSW 7 27879319 missense possibly damaging 0.54
R6010:Zfp607a UTSW 7 27877829 nonsense probably null
R6224:Zfp607a UTSW 7 27878582 missense probably damaging 1.00
R6939:Zfp607a UTSW 7 27879048 nonsense probably null
R6953:Zfp607a UTSW 7 27878365 missense possibly damaging 0.59
R7082:Zfp607a UTSW 7 27878758 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCCTTCAAGCATGTCTCCAGCC -3'
(R):5'- ACCAGTATGAATTCCCCAATATGCAGC -3'

Sequencing Primer
(F):5'- ACATAGGGTTATCCATGCCG -3'
(R):5'- ctccgccacaattcttcac -3'
Posted On2014-01-15