Incidental Mutation 'R1180:2610021A01Rik'
ID101480
Institutional Source Beutler Lab
Gene Symbol 2610021A01Rik
Ensembl Gene ENSMUSG00000091474
Gene NameRIKEN cDNA 2610021A01 gene
Synonyms
MMRRC Submission 039252-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R1180 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location41599230-41628533 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41625717 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 281 (D281E)
Ref Sequence ENSEMBL: ENSMUSP00000127760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163475]
Predicted Effect probably benign
Transcript: ENSMUST00000163475
AA Change: D281E

PolyPhen 2 Score 0.413 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000127760
Gene: ENSMUSG00000091474
AA Change: D281E

DomainStartEndE-ValueType
KRAB 18 78 1.32e-32 SMART
ZnF_C2H2 415 437 4.54e-4 SMART
ZnF_C2H2 443 465 3.69e-4 SMART
ZnF_C2H2 471 493 5.14e-3 SMART
ZnF_C2H2 499 521 4.94e-5 SMART
ZnF_C2H2 527 549 3.16e-3 SMART
ZnF_C2H2 555 577 3.16e-3 SMART
ZnF_C2H2 583 605 8.6e-5 SMART
ZnF_C2H2 611 633 1.79e-2 SMART
ZnF_C2H2 639 661 2.43e-4 SMART
ZnF_C2H2 667 689 1.72e-4 SMART
ZnF_C2H2 695 717 9.73e-4 SMART
ZnF_C2H2 723 745 2.02e-1 SMART
ZnF_C2H2 751 773 1.69e-3 SMART
ZnF_C2H2 779 801 3.69e-4 SMART
ZnF_C2H2 807 829 7.37e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206757
Meta Mutation Damage Score 0.1296 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.5%
  • 20x: 87.5%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 T G 8: 40,681,428 V645G probably damaging Het
Apcdd1 A T 18: 62,937,097 Y145F probably damaging Het
Cadps A G 14: 12,457,836 probably benign Het
Camk1d A T 2: 5,362,025 Y126* probably null Het
Chd8 A C 14: 52,221,108 S848A probably damaging Het
Col6a3 T C 1: 90,781,855 K1873R unknown Het
Cpd T C 11: 76,801,753 T753A possibly damaging Het
Cxcr2 A T 1: 74,158,368 D7V probably benign Het
Dock4 A G 12: 40,640,414 E173G possibly damaging Het
EU599041 G A 7: 43,226,307 noncoding transcript Het
Fer1l6 G A 15: 58,602,311 probably benign Het
Flt3 T C 5: 147,341,238 D842G probably damaging Het
Foxp4 G C 17: 47,880,353 probably benign Het
Fsip2 T C 2: 82,975,226 Y630H probably damaging Het
Gprin3 C A 6: 59,354,936 V129F possibly damaging Het
Gstm1 A G 3: 108,014,811 F170S probably damaging Het
Hoxa3 A C 6: 52,170,402 Y290* probably null Het
Htra4 G T 8: 25,033,719 L277I probably damaging Het
Jak2 A G 19: 29,282,499 Y266C probably damaging Het
Kif6 T A 17: 49,832,256 probably benign Het
Kiz C T 2: 146,970,007 R679C unknown Het
Kyat3 A C 3: 142,737,770 probably null Het
Mipep G A 14: 60,834,056 V537I probably damaging Het
Mrpl44 T A 1: 79,777,960 N94K probably damaging Het
Mstn A T 1: 53,064,008 T168S possibly damaging Het
Mx2 G A 16: 97,556,009 R434H probably damaging Het
Myh6 A G 14: 54,944,468 I1792T possibly damaging Het
Myo16 T C 8: 10,396,908 S450P probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Olfr1155 G A 2: 87,943,146 L161F probably benign Het
Olfr401 A G 11: 74,121,580 Y97C probably benign Het
Pdzd3 T A 9: 44,249,246 D284V probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Pkhd1 C T 1: 20,585,157 probably null Het
Psmd8 A T 7: 29,175,400 V248E probably benign Het
Ranbp2 A G 10: 58,465,463 Y646C probably damaging Het
Samsn1 C T 16: 75,873,648 G189E probably damaging Het
Sec61g A C 11: 16,504,722 probably benign Het
Sfmbt2 C T 2: 10,402,066 H59Y probably damaging Het
Shb T C 4: 45,423,996 I486V possibly damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Spag16 G A 1: 69,923,658 probably benign Het
Spink13 A G 18: 62,608,170 probably benign Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tk1 A G 11: 117,822,095 probably null Het
Tnni3k A T 3: 154,875,513 H600Q probably damaging Het
Ttn A T 2: 76,969,703 I387N probably damaging Het
Ube2q2 T C 9: 55,195,416 probably benign Het
Utp14b C A 1: 78,665,445 N353K probably damaging Het
Zfp474 C T 18: 52,638,742 Q156* probably null Het
Other mutations in 2610021A01Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:2610021A01Rik APN 7 41625572 missense possibly damaging 0.61
IGL00566:2610021A01Rik APN 7 41625391 missense possibly damaging 0.53
R0940:2610021A01Rik UTSW 7 41626434 missense probably damaging 1.00
R1101:2610021A01Rik UTSW 7 41627359 missense probably damaging 1.00
R1560:2610021A01Rik UTSW 7 41626042 missense probably benign 0.09
R1740:2610021A01Rik UTSW 7 41626125 nonsense probably null
R1988:2610021A01Rik UTSW 7 41626657 nonsense probably null
R2041:2610021A01Rik UTSW 7 41625979 missense possibly damaging 0.63
R2964:2610021A01Rik UTSW 7 41626405 nonsense probably null
R2965:2610021A01Rik UTSW 7 41626405 nonsense probably null
R2966:2610021A01Rik UTSW 7 41626405 nonsense probably null
R4002:2610021A01Rik UTSW 7 41625540 missense possibly damaging 0.83
R4569:2610021A01Rik UTSW 7 41625838 missense probably benign 0.04
R4708:2610021A01Rik UTSW 7 41611885 missense probably damaging 1.00
R4880:2610021A01Rik UTSW 7 41627105 missense possibly damaging 0.47
R4933:2610021A01Rik UTSW 7 41626802 missense probably damaging 0.98
R5036:2610021A01Rik UTSW 7 41626154 missense possibly damaging 0.92
R5206:2610021A01Rik UTSW 7 41626585 nonsense probably null
R5235:2610021A01Rik UTSW 7 41624832 missense possibly damaging 0.53
R6449:2610021A01Rik UTSW 7 41625874 nonsense probably null
R6488:2610021A01Rik UTSW 7 41625874 nonsense probably null
R6904:2610021A01Rik UTSW 7 41626092 nonsense probably null
X0067:2610021A01Rik UTSW 7 41627317 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGGAAGTGGAAGCCATCATTGGTTG -3'
(R):5'- ATTTGCATGGCGTTCCTCCAGG -3'

Sequencing Primer
(F):5'- GATTGCTTACCAAGGTAACGACTC -3'
(R):5'- GGATGCCCAACAAGTTTCG -3'
Posted On2014-01-15