Incidental Mutation 'R1180:Myo16'
ID101484
Institutional Source Beutler Lab
Gene Symbol Myo16
Ensembl Gene ENSMUSG00000039057
Gene Namemyosin XVI
SynonymsBM140241, C230040D10Rik, Nyap3
MMRRC Submission 039252-MU
Accession Numbers

Genbank: NM_001081397; MGI: 2685951

Is this an essential gene? Possibly non essential (E-score: 0.415) question?
Stock #R1180 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location10153911-10634742 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10396908 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 450 (S450P)
Ref Sequence ENSEMBL: ENSMUSP00000147072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042103] [ENSMUST00000207204] [ENSMUST00000207477] [ENSMUST00000208309]
Predicted Effect probably damaging
Transcript: ENSMUST00000042103
AA Change: S450P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049345
Gene: ENSMUSG00000039057
AA Change: S450P

DomainStartEndE-ValueType
ANK 92 121 1.65e-1 SMART
ANK 125 154 3.46e-4 SMART
ANK 158 189 2.11e2 SMART
ANK 221 250 2.85e-5 SMART
ANK 254 283 3.51e-5 SMART
low complexity region 333 349 N/A INTRINSIC
MYSc 394 1144 2.27e-144 SMART
IQ 1144 1166 4.06e-2 SMART
Pfam:NYAP_N 1207 1591 4.1e-135 PFAM
low complexity region 1670 1690 N/A INTRINSIC
low complexity region 1841 1860 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207204
Predicted Effect unknown
Transcript: ENSMUST00000207477
AA Change: S450P
Predicted Effect probably damaging
Transcript: ENSMUST00000208309
AA Change: S450P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.5%
  • 20x: 87.5%
Validation Efficiency 98% (55/56)
MGI Phenotype PHENOTYPE: Triple KO of Nyap1, Nyap2 and Myo16 results in decreased brain weight and cortex and striatum size and reduced neurite length in cortical neurons. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,625,717 D281E probably benign Het
Adam24 T G 8: 40,681,428 V645G probably damaging Het
Apcdd1 A T 18: 62,937,097 Y145F probably damaging Het
Cadps A G 14: 12,457,836 probably benign Het
Camk1d A T 2: 5,362,025 Y126* probably null Het
Chd8 A C 14: 52,221,108 S848A probably damaging Het
Col6a3 T C 1: 90,781,855 K1873R unknown Het
Cpd T C 11: 76,801,753 T753A possibly damaging Het
Cxcr2 A T 1: 74,158,368 D7V probably benign Het
Dock4 A G 12: 40,640,414 E173G possibly damaging Het
EU599041 G A 7: 43,226,307 noncoding transcript Het
Fer1l6 G A 15: 58,602,311 probably benign Het
Flt3 T C 5: 147,341,238 D842G probably damaging Het
Foxp4 G C 17: 47,880,353 probably benign Het
Fsip2 T C 2: 82,975,226 Y630H probably damaging Het
Gprin3 C A 6: 59,354,936 V129F possibly damaging Het
Gstm1 A G 3: 108,014,811 F170S probably damaging Het
Hoxa3 A C 6: 52,170,402 Y290* probably null Het
Htra4 G T 8: 25,033,719 L277I probably damaging Het
Jak2 A G 19: 29,282,499 Y266C probably damaging Het
Kif6 T A 17: 49,832,256 probably benign Het
Kiz C T 2: 146,970,007 R679C unknown Het
Kyat3 A C 3: 142,737,770 probably null Het
Mipep G A 14: 60,834,056 V537I probably damaging Het
Mrpl44 T A 1: 79,777,960 N94K probably damaging Het
Mstn A T 1: 53,064,008 T168S possibly damaging Het
Mx2 G A 16: 97,556,009 R434H probably damaging Het
Myh6 A G 14: 54,944,468 I1792T possibly damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Olfr1155 G A 2: 87,943,146 L161F probably benign Het
Olfr401 A G 11: 74,121,580 Y97C probably benign Het
Pdzd3 T A 9: 44,249,246 D284V probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Pkhd1 C T 1: 20,585,157 probably null Het
Psmd8 A T 7: 29,175,400 V248E probably benign Het
Ranbp2 A G 10: 58,465,463 Y646C probably damaging Het
Samsn1 C T 16: 75,873,648 G189E probably damaging Het
Sec61g A C 11: 16,504,722 probably benign Het
Sfmbt2 C T 2: 10,402,066 H59Y probably damaging Het
Shb T C 4: 45,423,996 I486V possibly damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Spag16 G A 1: 69,923,658 probably benign Het
Spink13 A G 18: 62,608,170 probably benign Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tk1 A G 11: 117,822,095 probably null Het
Tnni3k A T 3: 154,875,513 H600Q probably damaging Het
Ttn A T 2: 76,969,703 I387N probably damaging Het
Ube2q2 T C 9: 55,195,416 probably benign Het
Utp14b C A 1: 78,665,445 N353K probably damaging Het
Zfp474 C T 18: 52,638,742 Q156* probably null Het
Other mutations in Myo16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Myo16 APN 8 10438889 missense probably damaging 1.00
IGL00567:Myo16 APN 8 10462154 missense probably damaging 1.00
IGL00671:Myo16 APN 8 10361067 missense probably damaging 1.00
IGL00897:Myo16 APN 8 10315518 missense probably damaging 1.00
IGL01458:Myo16 APN 8 10435853 missense probably damaging 1.00
IGL01523:Myo16 APN 8 10370908 missense probably damaging 1.00
IGL01532:Myo16 APN 8 10400551 missense probably benign 0.00
IGL01680:Myo16 APN 8 10272630 missense probably damaging 1.00
IGL01747:Myo16 APN 8 10604877 missense probably damaging 1.00
IGL02084:Myo16 APN 8 10361088 missense probably damaging 0.99
IGL02203:Myo16 APN 8 10570132 missense possibly damaging 0.52
IGL02506:Myo16 APN 8 10390217 missense probably damaging 1.00
IGL02819:Myo16 APN 8 10322600 missense probably damaging 1.00
IGL02935:Myo16 APN 8 10532990 missense probably benign 0.41
IGL02943:Myo16 APN 8 10400595 splice site probably benign
IGL03347:Myo16 APN 8 10376120 critical splice acceptor site probably null
3-1:Myo16 UTSW 8 10438869 missense probably damaging 0.99
P0016:Myo16 UTSW 8 10400596 splice site probably benign
R0006:Myo16 UTSW 8 10475988 missense probably damaging 0.98
R0006:Myo16 UTSW 8 10475988 missense probably damaging 0.98
R0033:Myo16 UTSW 8 10370955 missense probably damaging 1.00
R0033:Myo16 UTSW 8 10370955 missense probably damaging 1.00
R0142:Myo16 UTSW 8 10569790 missense probably benign 0.01
R0195:Myo16 UTSW 8 10315538 splice site probably benign
R0418:Myo16 UTSW 8 10569918 missense probably benign 0.01
R0576:Myo16 UTSW 8 10562318 critical splice donor site probably null
R0627:Myo16 UTSW 8 10439689 missense probably benign 0.15
R0826:Myo16 UTSW 8 10376285 splice site probably benign
R0835:Myo16 UTSW 8 10272766 missense probably damaging 1.00
R1015:Myo16 UTSW 8 10390183 missense probably benign 0.17
R1052:Myo16 UTSW 8 10570181 missense possibly damaging 0.92
R1185:Myo16 UTSW 8 10633624 missense probably damaging 1.00
R1185:Myo16 UTSW 8 10633624 missense probably damaging 1.00
R1474:Myo16 UTSW 8 10502796 missense probably damaging 1.00
R1484:Myo16 UTSW 8 10560145 missense probably damaging 1.00
R1503:Myo16 UTSW 8 10502817 missense probably benign 0.44
R1733:Myo16 UTSW 8 10442283 missense probably damaging 0.98
R1873:Myo16 UTSW 8 10272789 missense probably damaging 1.00
R1885:Myo16 UTSW 8 10322656 missense probably damaging 1.00
R1943:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2013:Myo16 UTSW 8 10502796 missense probably damaging 1.00
R2019:Myo16 UTSW 8 10376260 missense probably benign 0.05
R2022:Myo16 UTSW 8 10272633 missense probably benign 0.08
R2214:Myo16 UTSW 8 10438803 missense probably damaging 1.00
R2228:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2351:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2352:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2357:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2566:Myo16 UTSW 8 10594820 missense probably benign 0.43
R3402:Myo16 UTSW 8 10384719 missense probably benign
R3870:Myo16 UTSW 8 10442239 missense probably benign 0.25
R4080:Myo16 UTSW 8 10562240 missense probably damaging 1.00
R4498:Myo16 UTSW 8 10435869 missense probably benign 0.01
R4631:Myo16 UTSW 8 10506984 missense probably damaging 1.00
R4689:Myo16 UTSW 8 10438890 missense probably damaging 1.00
R4736:Myo16 UTSW 8 10373527 missense probably damaging 1.00
R4738:Myo16 UTSW 8 10373527 missense probably damaging 1.00
R4739:Myo16 UTSW 8 10373527 missense probably damaging 1.00
R4764:Myo16 UTSW 8 10435880 missense probably damaging 1.00
R4778:Myo16 UTSW 8 10569694 missense probably damaging 0.97
R4852:Myo16 UTSW 8 10373474 missense probably damaging 1.00
R4885:Myo16 UTSW 8 10438892 missense probably damaging 0.98
R4993:Myo16 UTSW 8 10476094 missense probably damaging 0.99
R5077:Myo16 UTSW 8 10322658 missense probably damaging 1.00
R5135:Myo16 UTSW 8 10476114 missense probably benign
R5170:Myo16 UTSW 8 10569745 missense probably benign 0.30
R5203:Myo16 UTSW 8 10360995 missense probably damaging 1.00
R5246:Myo16 UTSW 8 10562212 nonsense probably null
R5517:Myo16 UTSW 8 10560226 missense probably benign 0.22
R5567:Myo16 UTSW 8 10322676 missense probably damaging 1.00
R5694:Myo16 UTSW 8 10569606 missense probably benign 0.01
R5749:Myo16 UTSW 8 10413245 missense probably benign 0.01
R6131:Myo16 UTSW 8 10569877 missense probably benign
R6213:Myo16 UTSW 8 10370963 critical splice donor site probably null
R6216:Myo16 UTSW 8 10315494 missense probably benign 0.01
R6240:Myo16 UTSW 8 10370930 missense probably damaging 1.00
R6628:Myo16 UTSW 8 10570638 missense probably damaging 0.99
R6935:Myo16 UTSW 8 10569820 missense probably benign 0.37
R6996:Myo16 UTSW 8 10569496 missense probably damaging 1.00
R7103:Myo16 UTSW 8 10569673 missense unknown
R7164:Myo16 UTSW 8 10569585 missense unknown
R7255:Myo16 UTSW 8 10499169 missense unknown
R7266:Myo16 UTSW 8 10272687 missense unknown
R7398:Myo16 UTSW 8 10562183 missense unknown
X0066:Myo16 UTSW 8 10376185 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCCTAAGCTGCCTCCCC -3'
(R):5'- CCCCAAAGTTGCCTCAGAACACATT -3'

Sequencing Primer
(F):5'- tgcctttatatctcattgcttcaac -3'
(R):5'- TTGCCTCAGAACACATTAACATAATC -3'
Posted On2014-01-15