Incidental Mutation 'R1180:Ranbp2'
ID101494
Institutional Source Beutler Lab
Gene Symbol Ranbp2
Ensembl Gene ENSMUSG00000003226
Gene NameRAN binding protein 2
SynonymsA430087B05Rik
MMRRC Submission 039252-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1180 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location58446920-58494356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58465463 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 646 (Y646C)
Ref Sequence ENSEMBL: ENSMUSP00000003310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003310]
Predicted Effect probably damaging
Transcript: ENSMUST00000003310
AA Change: Y646C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003310
Gene: ENSMUSG00000003226
AA Change: Y646C

DomainStartEndE-ValueType
Pfam:TPR_1 60 93 1.8e-7 PFAM
Pfam:TPR_8 60 93 8.9e-6 PFAM
low complexity region 235 247 N/A INTRINSIC
low complexity region 778 801 N/A INTRINSIC
coiled coil region 808 832 N/A INTRINSIC
RanBD 1166 1295 6.47e-64 SMART
ZnF_RBZ 1348 1372 5.49e-2 SMART
ZnF_RBZ 1412 1436 3.06e-6 SMART
ZnF_RBZ 1471 1495 4.16e-8 SMART
ZnF_RBZ 1500 1524 4.57e-5 SMART
ZnF_RBZ 1560 1584 3.52e-6 SMART
ZnF_RBZ 1619 1643 1.35e-7 SMART
RanBD 1850 1979 2.84e-60 SMART
low complexity region 2034 2048 N/A INTRINSIC
low complexity region 2069 2090 N/A INTRINSIC
low complexity region 2106 2121 N/A INTRINSIC
RanBD 2147 2276 4.96e-83 SMART
low complexity region 2310 2317 N/A INTRINSIC
low complexity region 2328 2342 N/A INTRINSIC
Pfam:IR1-M 2468 2530 2.5e-27 PFAM
Pfam:IR1-M 2544 2604 7e-30 PFAM
low complexity region 2673 2684 N/A INTRINSIC
low complexity region 2722 2732 N/A INTRINSIC
RanBD 2741 2869 5e-79 SMART
Pfam:Pro_isomerase 2896 3052 4.5e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220131
Meta Mutation Damage Score 0.19 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.5%
  • 20x: 87.5%
Validation Efficiency 98% (55/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality. Heterozygous mice on some backgrounds display reduced ATP levels in the CNS, decreased glucose clearance, decreased weight gain on a high fat diet, and reduced scotopic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,625,717 D281E probably benign Het
Adam24 T G 8: 40,681,428 V645G probably damaging Het
Apcdd1 A T 18: 62,937,097 Y145F probably damaging Het
Cadps A G 14: 12,457,836 probably benign Het
Camk1d A T 2: 5,362,025 Y126* probably null Het
Chd8 A C 14: 52,221,108 S848A probably damaging Het
Col6a3 T C 1: 90,781,855 K1873R unknown Het
Cpd T C 11: 76,801,753 T753A possibly damaging Het
Cxcr2 A T 1: 74,158,368 D7V probably benign Het
Dock4 A G 12: 40,640,414 E173G possibly damaging Het
EU599041 G A 7: 43,226,307 noncoding transcript Het
Fer1l6 G A 15: 58,602,311 probably benign Het
Flt3 T C 5: 147,341,238 D842G probably damaging Het
Foxp4 G C 17: 47,880,353 probably benign Het
Fsip2 T C 2: 82,975,226 Y630H probably damaging Het
Gprin3 C A 6: 59,354,936 V129F possibly damaging Het
Gstm1 A G 3: 108,014,811 F170S probably damaging Het
Hoxa3 A C 6: 52,170,402 Y290* probably null Het
Htra4 G T 8: 25,033,719 L277I probably damaging Het
Jak2 A G 19: 29,282,499 Y266C probably damaging Het
Kif6 T A 17: 49,832,256 probably benign Het
Kiz C T 2: 146,970,007 R679C unknown Het
Kyat3 A C 3: 142,737,770 probably null Het
Mipep G A 14: 60,834,056 V537I probably damaging Het
Mrpl44 T A 1: 79,777,960 N94K probably damaging Het
Mstn A T 1: 53,064,008 T168S possibly damaging Het
Mx2 G A 16: 97,556,009 R434H probably damaging Het
Myh6 A G 14: 54,944,468 I1792T possibly damaging Het
Myo16 T C 8: 10,396,908 S450P probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Olfr1155 G A 2: 87,943,146 L161F probably benign Het
Olfr401 A G 11: 74,121,580 Y97C probably benign Het
Pdzd3 T A 9: 44,249,246 D284V probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Pkhd1 C T 1: 20,585,157 probably null Het
Psmd8 A T 7: 29,175,400 V248E probably benign Het
Samsn1 C T 16: 75,873,648 G189E probably damaging Het
Sec61g A C 11: 16,504,722 probably benign Het
Sfmbt2 C T 2: 10,402,066 H59Y probably damaging Het
Shb T C 4: 45,423,996 I486V possibly damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Spag16 G A 1: 69,923,658 probably benign Het
Spink13 A G 18: 62,608,170 probably benign Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tk1 A G 11: 117,822,095 probably null Het
Tnni3k A T 3: 154,875,513 H600Q probably damaging Het
Ttn A T 2: 76,969,703 I387N probably damaging Het
Ube2q2 T C 9: 55,195,416 probably benign Het
Utp14b C A 1: 78,665,445 N353K probably damaging Het
Zfp474 C T 18: 52,638,742 Q156* probably null Het
Other mutations in Ranbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ranbp2 APN 10 58477256 missense probably damaging 1.00
IGL00336:Ranbp2 APN 10 58451984 missense probably damaging 1.00
IGL00486:Ranbp2 APN 10 58477612 missense probably benign 0.06
IGL00800:Ranbp2 APN 10 58490704 missense probably benign
IGL00834:Ranbp2 APN 10 58453323 missense possibly damaging 0.94
IGL00852:Ranbp2 APN 10 58477901 missense probably benign
IGL00984:Ranbp2 APN 10 58461964 nonsense probably null
IGL01299:Ranbp2 APN 10 58492817 missense probably damaging 1.00
IGL01325:Ranbp2 APN 10 58476298 missense probably damaging 0.99
IGL01444:Ranbp2 APN 10 58475300 missense possibly damaging 0.79
IGL01545:Ranbp2 APN 10 58478881 missense possibly damaging 0.48
IGL01619:Ranbp2 APN 10 58464078 splice site probably null
IGL01782:Ranbp2 APN 10 58478309 missense probably damaging 0.97
IGL02020:Ranbp2 APN 10 58479947 missense probably damaging 1.00
IGL02096:Ranbp2 APN 10 58461967 missense probably damaging 1.00
IGL02182:Ranbp2 APN 10 58485760 nonsense probably null
IGL02211:Ranbp2 APN 10 58478242 missense probably benign
IGL02249:Ranbp2 APN 10 58480078 missense possibly damaging 0.89
IGL02268:Ranbp2 APN 10 58493653 unclassified probably benign
IGL02421:Ranbp2 APN 10 58480554 missense probably damaging 1.00
IGL03080:Ranbp2 APN 10 58476791 missense probably benign 0.01
IGL03119:Ranbp2 APN 10 58452003 missense probably damaging 1.00
IGL03206:Ranbp2 APN 10 58465547 missense probably damaging 1.00
IGL03237:Ranbp2 APN 10 58492961 missense probably damaging 0.98
En_passant UTSW 10 58452017 missense probably damaging 1.00
red_river UTSW 10 58465667 missense probably damaging 1.00
IGL02799:Ranbp2 UTSW 10 58480264 missense probably damaging 1.00
R0058:Ranbp2 UTSW 10 58480531 missense probably damaging 0.98
R0058:Ranbp2 UTSW 10 58480531 missense probably damaging 0.98
R0145:Ranbp2 UTSW 10 58480046 missense probably damaging 1.00
R0309:Ranbp2 UTSW 10 58479868 missense probably benign 0.04
R0375:Ranbp2 UTSW 10 58477283 missense probably damaging 1.00
R0441:Ranbp2 UTSW 10 58485768 missense probably benign 0.40
R0494:Ranbp2 UTSW 10 58467432 missense possibly damaging 0.53
R0542:Ranbp2 UTSW 10 58478414 missense probably benign 0.02
R0565:Ranbp2 UTSW 10 58476336 missense probably benign 0.41
R0608:Ranbp2 UTSW 10 58493898 missense probably damaging 1.00
R0661:Ranbp2 UTSW 10 58478733 missense probably benign
R0670:Ranbp2 UTSW 10 58480698 missense probably benign 0.01
R0760:Ranbp2 UTSW 10 58476791 missense possibly damaging 0.70
R0811:Ranbp2 UTSW 10 58465529 missense probably benign 0.01
R0812:Ranbp2 UTSW 10 58465529 missense probably benign 0.01
R1196:Ranbp2 UTSW 10 58477053 missense probably damaging 1.00
R1216:Ranbp2 UTSW 10 58483212 splice site probably benign
R1374:Ranbp2 UTSW 10 58485893 splice site probably benign
R1541:Ranbp2 UTSW 10 58483094 missense possibly damaging 0.90
R1589:Ranbp2 UTSW 10 58463986 missense probably benign 0.01
R1711:Ranbp2 UTSW 10 58460519 missense probably benign 0.11
R1761:Ranbp2 UTSW 10 58485741 missense probably benign 0.02
R1831:Ranbp2 UTSW 10 58479222 nonsense probably null
R1840:Ranbp2 UTSW 10 58478766 missense probably benign 0.41
R1869:Ranbp2 UTSW 10 58492561 missense probably damaging 1.00
R1871:Ranbp2 UTSW 10 58492561 missense probably damaging 1.00
R1892:Ranbp2 UTSW 10 58464099 missense probably benign 0.36
R2270:Ranbp2 UTSW 10 58455927 missense probably benign 0.06
R2363:Ranbp2 UTSW 10 58478936 missense possibly damaging 0.79
R3844:Ranbp2 UTSW 10 58477895 missense possibly damaging 0.87
R3937:Ranbp2 UTSW 10 58476472 missense probably benign 0.00
R3938:Ranbp2 UTSW 10 58476472 missense probably benign 0.00
R4025:Ranbp2 UTSW 10 58480556 missense probably benign 0.23
R4183:Ranbp2 UTSW 10 58465666 missense possibly damaging 0.53
R4247:Ranbp2 UTSW 10 58478864 missense possibly damaging 0.79
R4334:Ranbp2 UTSW 10 58463994 missense probably damaging 1.00
R4656:Ranbp2 UTSW 10 58453422 missense possibly damaging 0.82
R4746:Ranbp2 UTSW 10 58492670 missense probably damaging 1.00
R4852:Ranbp2 UTSW 10 58477056 missense possibly damaging 0.94
R4863:Ranbp2 UTSW 10 58492421 missense probably damaging 0.99
R5011:Ranbp2 UTSW 10 58461895 missense probably benign 0.36
R5014:Ranbp2 UTSW 10 58464120 missense probably benign 0.40
R5145:Ranbp2 UTSW 10 58480038 missense probably damaging 1.00
R5178:Ranbp2 UTSW 10 58476785 missense probably benign 0.01
R5199:Ranbp2 UTSW 10 58464443 missense probably benign
R5294:Ranbp2 UTSW 10 58478668 missense probably benign 0.23
R5508:Ranbp2 UTSW 10 58480005 missense probably damaging 0.97
R5511:Ranbp2 UTSW 10 58493739 missense probably benign 0.29
R5575:Ranbp2 UTSW 10 58492583 missense probably damaging 1.00
R5617:Ranbp2 UTSW 10 58465667 missense probably damaging 1.00
R5630:Ranbp2 UTSW 10 58479076 missense probably damaging 1.00
R5733:Ranbp2 UTSW 10 58485836 missense probably damaging 1.00
R5751:Ranbp2 UTSW 10 58464264 splice site probably null
R5767:Ranbp2 UTSW 10 58476825 missense probably benign 0.02
R6122:Ranbp2 UTSW 10 58465529 missense probably benign 0.02
R6147:Ranbp2 UTSW 10 58479428 missense probably damaging 1.00
R6286:Ranbp2 UTSW 10 58479572 missense probably benign 0.02
R6344:Ranbp2 UTSW 10 58483886 splice site probably null
R6452:Ranbp2 UTSW 10 58478157 missense probably benign 0.00
R6487:Ranbp2 UTSW 10 58485741 missense probably benign 0.02
R6620:Ranbp2 UTSW 10 58455807 critical splice acceptor site probably null
R6759:Ranbp2 UTSW 10 58457737 nonsense probably null
R7010:Ranbp2 UTSW 10 58454571 critical splice acceptor site probably null
R7071:Ranbp2 UTSW 10 58492837 missense probably damaging 1.00
R7083:Ranbp2 UTSW 10 58479230 missense probably damaging 1.00
R7088:Ranbp2 UTSW 10 58463906 missense probably damaging 1.00
R7102:Ranbp2 UTSW 10 58463950 missense probably damaging 1.00
R7194:Ranbp2 UTSW 10 58476769 missense probably benign 0.05
R7217:Ranbp2 UTSW 10 58452017 missense probably damaging 1.00
R7318:Ranbp2 UTSW 10 58483087 nonsense probably null
R7341:Ranbp2 UTSW 10 58485797 missense possibly damaging 0.72
R7398:Ranbp2 UTSW 10 58467277 missense probably damaging 1.00
R7424:Ranbp2 UTSW 10 58479194 missense probably damaging 0.98
X0018:Ranbp2 UTSW 10 58478584 missense probably benign 0.13
X0022:Ranbp2 UTSW 10 58465155 missense probably benign 0.33
Z1088:Ranbp2 UTSW 10 58477972 frame shift probably null
Z1088:Ranbp2 UTSW 10 58477983 frame shift probably null
Z1088:Ranbp2 UTSW 10 58492893 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- ACGGGAATACATAGGCAGAAGTGTTCAT -3'
(R):5'- TTCTTCAGGAGACAAGGCATCATTTTCA -3'

Sequencing Primer
(F):5'- CATAGGCAGAAGTGTTCATTATTGG -3'
(R):5'- GATTTTTCAaagcaagcaagcaaac -3'
Posted On2014-01-15