Incidental Mutation 'R1181:Tbc1d7'
ID101605
Institutional Source Beutler Lab
Gene Symbol Tbc1d7
Ensembl Gene ENSMUSG00000021368
Gene NameTBC1 domain family, member 7
Synonyms
MMRRC Submission 039253-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.714) question?
Stock #R1181 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location43151740-43171501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43153139 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 242 (I242M)
Ref Sequence ENSEMBL: ENSMUSP00000137280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021797] [ENSMUST00000179852] [ENSMUST00000220787] [ENSMUST00000221352] [ENSMUST00000221795] [ENSMUST00000222160] [ENSMUST00000223000]
Predicted Effect probably damaging
Transcript: ENSMUST00000021797
AA Change: I242M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021797
Gene: ENSMUSG00000021368
AA Change: I242M

DomainStartEndE-ValueType
SCOP:d1fkma1 24 90 5e-3 SMART
Pfam:RabGAP-TBC 133 251 2.6e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179852
AA Change: I242M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137280
Gene: ENSMUSG00000021368
AA Change: I242M

DomainStartEndE-ValueType
SCOP:d1fkma1 24 90 5e-3 SMART
Pfam:RabGAP-TBC 133 251 5.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220579
Predicted Effect probably benign
Transcript: ENSMUST00000220787
Predicted Effect probably benign
Transcript: ENSMUST00000221352
Predicted Effect probably benign
Transcript: ENSMUST00000221795
Predicted Effect probably damaging
Transcript: ENSMUST00000222160
AA Change: I242M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000223000
AA Change: I120M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223076
Meta Mutation Damage Score 0.0216 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 97.9%
  • 10x: 93.9%
  • 20x: 84.2%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the TBC-domain containing protein family. The encoded protein functions as a subunit of the tuberous sclerosis TSC1-TSC2 complex which plays a role in the regulation of cellular growth and differentiation. Mutations in this gene have been associated with autosomal recessive megalencephaly. Alternative splicing results in multiple transcript variants. Naturally occurring readthrough transcription occurs between this locus and downstream LOC100130357. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 T A 19: 4,872,610 Q64L probably benign Het
Ankrd12 T C 17: 66,042,574 N88S probably benign Het
Apcdd1 A T 18: 62,937,097 Y145F probably damaging Het
Bnipl C A 3: 95,245,649 probably null Het
Bod1 T C 11: 31,666,943 probably benign Het
Cbarp G T 10: 80,135,494 H166N probably damaging Het
Cdr2l T A 11: 115,394,179 I447N probably damaging Het
Cped1 T G 6: 22,215,562 I698M probably damaging Het
Ecm1 G A 3: 95,735,350 H404Y possibly damaging Het
Ehbp1 C T 11: 22,062,831 V902I probably benign Het
Eps8 T C 6: 137,522,854 Q209R possibly damaging Het
Fastk C T 5: 24,441,731 probably null Het
Gm6797 T A X: 8,641,765 noncoding transcript Het
Gp1ba C T 11: 70,641,427 P673L probably damaging Het
Gstm1 A G 3: 108,014,811 F170S probably damaging Het
Hgf G C 5: 16,618,925 G707R probably damaging Het
Klhl5 T C 5: 65,162,885 M594T probably damaging Het
Kyat3 A C 3: 142,737,770 probably null Het
Mettl14 C T 3: 123,374,002 G236S probably damaging Het
Nob1 G A 8: 107,421,490 P107S probably damaging Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr1155 G A 2: 87,943,146 L161F probably benign Het
Olfr1463 C A 19: 13,234,831 H194N probably benign Het
Olfr444 T A 6: 42,955,558 L20Q probably benign Het
Olfr503 C A 7: 108,545,302 T257N probably benign Het
Olfr676 T A 7: 105,035,814 N205K probably damaging Het
Olfr808 A G 10: 129,768,164 I223V probably benign Het
Pald1 A G 10: 61,347,587 probably benign Het
Pds5a A T 5: 65,627,202 probably null Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plekha2 A C 8: 25,059,202 S189A probably benign Het
Prune2 T C 19: 17,123,105 V1991A probably benign Het
Sec61g A C 11: 16,504,722 probably benign Het
Serinc3 T C 2: 163,625,526 K445R probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Slfn8 T C 11: 83,016,745 E324G probably benign Het
Spink13 A G 18: 62,608,170 probably benign Het
Tas2r121 A T 6: 132,700,169 I280N probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tnni3k A T 3: 154,875,513 H600Q probably damaging Het
Trim66 C T 7: 109,484,577 probably null Het
Ttn A T 2: 76,969,703 I387N probably damaging Het
Tulp3 A T 6: 128,325,952 H301Q possibly damaging Het
Ubqln5 T A 7: 104,128,741 Q292L probably damaging Het
Zfp454 T C 11: 50,873,586 K229E probably damaging Het
Other mutations in Tbc1d7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Tbc1d7 APN 13 43159321 missense probably damaging 1.00
IGL01460:Tbc1d7 APN 13 43165359 missense probably benign 0.00
IGL02653:Tbc1d7 APN 13 43165398 missense probably benign
IGL03046:Tbc1d7 APN 13 43154686 splice site probably null
R0165:Tbc1d7 UTSW 13 43153202 splice site probably null
R0427:Tbc1d7 UTSW 13 43153087 missense probably benign 0.01
R0863:Tbc1d7 UTSW 13 43154685 splice site probably benign
R0930:Tbc1d7 UTSW 13 43165336 nonsense probably null
R1792:Tbc1d7 UTSW 13 43165377 missense probably benign
R2113:Tbc1d7 UTSW 13 43153086 missense probably damaging 0.99
R4354:Tbc1d7 UTSW 13 43169868 missense probably damaging 1.00
R4743:Tbc1d7 UTSW 13 43169849 missense probably damaging 1.00
R5407:Tbc1d7 UTSW 13 43154702 missense probably benign 0.01
R6049:Tbc1d7 UTSW 13 43159360 missense probably damaging 0.99
R6320:Tbc1d7 UTSW 13 43152933 unclassified probably benign
R7024:Tbc1d7 UTSW 13 43154735 missense probably damaging 1.00
R7241:Tbc1d7 UTSW 13 43153017 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ATTTGTTCCACTCCCAGGAGGCAC -3'
(R):5'- TTCACAGTCGTTCTCTGAAGCATGG -3'

Sequencing Primer
(F):5'- ggcaggaggattaccaaaaac -3'
(R):5'- CTCTGAAGCATGGACTTAAAATGAG -3'
Posted On2014-01-15