Incidental Mutation 'R1181:Olfr1463'
ID101615
Institutional Source Beutler Lab
Gene Symbol Olfr1463
Ensembl Gene ENSMUSG00000096365
Gene Nameolfactory receptor 1463
SynonymsMOR202-29P, GA_x6K02T2RE5P-3560863-3561795
MMRRC Submission 039253-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R1181 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13231328-13236400 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 13234831 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 194 (H194N)
Ref Sequence ENSEMBL: ENSMUSP00000146566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064102] [ENSMUST00000207246]
Predicted Effect probably benign
Transcript: ENSMUST00000064102
AA Change: H194N

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000070872
Gene: ENSMUSG00000096365
AA Change: H194N

DomainStartEndE-ValueType
Pfam:7tm_4 32 310 1e-51 PFAM
Pfam:7TM_GPCR_Srsx 36 306 3.2e-6 PFAM
Pfam:7tm_1 42 291 1.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207246
AA Change: H194N

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.09 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 97.9%
  • 10x: 93.9%
  • 20x: 84.2%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 T A 19: 4,872,610 Q64L probably benign Het
Ankrd12 T C 17: 66,042,574 N88S probably benign Het
Apcdd1 A T 18: 62,937,097 Y145F probably damaging Het
Bnipl C A 3: 95,245,649 probably null Het
Bod1 T C 11: 31,666,943 probably benign Het
Cbarp G T 10: 80,135,494 H166N probably damaging Het
Cdr2l T A 11: 115,394,179 I447N probably damaging Het
Cped1 T G 6: 22,215,562 I698M probably damaging Het
Ecm1 G A 3: 95,735,350 H404Y possibly damaging Het
Ehbp1 C T 11: 22,062,831 V902I probably benign Het
Eps8 T C 6: 137,522,854 Q209R possibly damaging Het
Fastk C T 5: 24,441,731 probably null Het
Gm6797 T A X: 8,641,765 noncoding transcript Het
Gp1ba C T 11: 70,641,427 P673L probably damaging Het
Gstm1 A G 3: 108,014,811 F170S probably damaging Het
Hgf G C 5: 16,618,925 G707R probably damaging Het
Klhl5 T C 5: 65,162,885 M594T probably damaging Het
Kyat3 A C 3: 142,737,770 probably null Het
Mettl14 C T 3: 123,374,002 G236S probably damaging Het
Nob1 G A 8: 107,421,490 P107S probably damaging Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr1155 G A 2: 87,943,146 L161F probably benign Het
Olfr444 T A 6: 42,955,558 L20Q probably benign Het
Olfr503 C A 7: 108,545,302 T257N probably benign Het
Olfr676 T A 7: 105,035,814 N205K probably damaging Het
Olfr808 A G 10: 129,768,164 I223V probably benign Het
Pald1 A G 10: 61,347,587 probably benign Het
Pds5a A T 5: 65,627,202 probably null Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plekha2 A C 8: 25,059,202 S189A probably benign Het
Prune2 T C 19: 17,123,105 V1991A probably benign Het
Sec61g A C 11: 16,504,722 probably benign Het
Serinc3 T C 2: 163,625,526 K445R probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Slfn8 T C 11: 83,016,745 E324G probably benign Het
Spink13 A G 18: 62,608,170 probably benign Het
Tas2r121 A T 6: 132,700,169 I280N probably damaging Het
Tbc1d7 T C 13: 43,153,139 I242M probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tnni3k A T 3: 154,875,513 H600Q probably damaging Het
Trim66 C T 7: 109,484,577 probably null Het
Ttn A T 2: 76,969,703 I387N probably damaging Het
Tulp3 A T 6: 128,325,952 H301Q possibly damaging Het
Ubqln5 T A 7: 104,128,741 Q292L probably damaging Het
Zfp454 T C 11: 50,873,586 K229E probably damaging Het
Other mutations in Olfr1463
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01131:Olfr1463 APN 19 13234739 missense probably benign 0.01
IGL02596:Olfr1463 APN 19 13234399 missense probably damaging 1.00
IGL03030:Olfr1463 APN 19 13235054 missense probably damaging 0.98
IGL03232:Olfr1463 APN 19 13234977 nonsense probably null
IGL03380:Olfr1463 APN 19 13235001 missense probably benign 0.00
PIT4382001:Olfr1463 UTSW 19 13234895 missense probably damaging 1.00
PIT4519001:Olfr1463 UTSW 19 13234852 missense probably benign 0.00
R0652:Olfr1463 UTSW 19 13234535 missense possibly damaging 0.80
R0658:Olfr1463 UTSW 19 13235060 missense possibly damaging 0.94
R1239:Olfr1463 UTSW 19 13234676 missense possibly damaging 0.80
R1316:Olfr1463 UTSW 19 13234439 missense probably damaging 1.00
R1465:Olfr1463 UTSW 19 13234901 missense possibly damaging 0.61
R1465:Olfr1463 UTSW 19 13234901 missense possibly damaging 0.61
R1900:Olfr1463 UTSW 19 13234913 missense possibly damaging 0.54
R1927:Olfr1463 UTSW 19 13235029 missense probably damaging 1.00
R2239:Olfr1463 UTSW 19 13234721 missense probably benign 0.00
R2380:Olfr1463 UTSW 19 13234721 missense probably benign 0.00
R3760:Olfr1463 UTSW 19 13234886 missense probably damaging 1.00
R3765:Olfr1463 UTSW 19 13234431 missense probably damaging 1.00
R3835:Olfr1463 UTSW 19 13234739 missense probably benign 0.18
R4690:Olfr1463 UTSW 19 13234768 missense possibly damaging 0.91
R4907:Olfr1463 UTSW 19 13234793 missense probably damaging 1.00
R5444:Olfr1463 UTSW 19 13234958 missense probably benign 0.28
R5465:Olfr1463 UTSW 19 13234688 missense probably benign 0.00
R6083:Olfr1463 UTSW 19 13234525 missense probably benign 0.01
R6259:Olfr1463 UTSW 19 13234421 missense probably damaging 0.98
R6324:Olfr1463 UTSW 19 13235104 missense possibly damaging 0.95
R6561:Olfr1463 UTSW 19 13235030 missense probably damaging 1.00
R6845:Olfr1463 UTSW 19 13234633 missense probably damaging 1.00
R7260:Olfr1463 UTSW 19 13235024 missense probably damaging 0.98
X0063:Olfr1463 UTSW 19 13234635 missense probably damaging 1.00
X0067:Olfr1463 UTSW 19 13234697 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GGGACTTACTGATGATCCAGGACTGC -3'
(R):5'- CCATTGAATGTCTAGAGCTTGGCTGC -3'

Sequencing Primer
(F):5'- ACATTTTCACCCTGGTAGGGAAC -3'
(R):5'- GTCTAGAGCTTGGCTGCAAATAC -3'
Posted On2014-01-15