Mutagenetix > Incidental Mutation

Incidental Mutation 'R1182:Psmc3'

101631

Institutional Source

Beutler Lab

Gene Symbol

Psmc3

Ensembl Gene

ENSMUSG00000002102

Gene Name

proteasome (prosome, macropain) 26S subunit, ATPase 3

Synonyms

Tat binding protein 1, TBP-1

MMRRC Submission

039254-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1182 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

90884361-90889783 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 90886380 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 179 (I179T)

Ref Sequence

ENSEMBL: ENSMUSP00000139782 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002171] [ENSMUST00000067663] [ENSMUST00000111441] [ENSMUST00000185715]

AlphaFold

O88685

Predicted Effect

probably damaging
Transcript: ENSMUST00000002171
AA Change: I198T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000002171
Gene: ENSMUSG00000002102
AA Change: I198T

Domain	Start	End	E-Value	Type
AAA	222	361	6.65e-22	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000067663
AA Change: I198T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000071054
Gene: ENSMUSG00000002102
AA Change: I198T

Domain	Start	End	E-Value	Type
AAA	222	361	6.65e-22	SMART
Blast:AAA	390	436	9e-20	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000111441
AA Change: I156T

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000107068
Gene: ENSMUSG00000002102
AA Change: I156T

Domain	Start	End	E-Value	Type
AAA	180	319	6.65e-22	SMART
Blast:AAA	348	394	8e-20	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131473

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141462

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144822

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145317

Predicted Effect

probably damaging
Transcript: ENSMUST00000185715
AA Change: I179T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000139782
Gene: ENSMUSG00000002102
AA Change: I179T

Domain	Start	End	E-Value	Type
AAA	203	301	9e-14	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000146506
AA Change: I180T

SMART Domains

Protein: ENSMUSP00000121688
Gene: ENSMUSG00000002102
AA Change: I180T

Domain	Start	End	E-Value	Type
PDB:4CR4\|M	13	183	2e-69	PDB
Blast:AAA	140	183	1e-20	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152269

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146633

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151419

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases that have chaperone-like activity. This subunit may compete with PSMC2 for binding to the HIV tat protein to regulate the interaction between the viral protein and the transcription complex. A pseudogene has been identified on chromosome 9. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 19 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl1	T	A	8: 84,656,451 (GRCm39)	D256E	probably damaging	Het
Adnp	G	A	2: 168,026,716 (GRCm39)	A193V	possibly damaging	Het
Atf7ip2	T	C	16: 10,059,699 (GRCm39)	L413S	possibly damaging	Het
Clip1	T	C	5: 123,785,928 (GRCm39)	N252S	probably damaging	Het
Cubn	A	T	2: 13,449,811 (GRCm39)	N904K	probably damaging	Het
Draxin	T	C	4: 148,192,394 (GRCm39)	E306G	probably damaging	Het
Gabrr1	T	A	4: 33,132,680 (GRCm39)	F9L	probably benign	Het
Hyal6	T	A	6: 24,743,416 (GRCm39)	C371S	probably damaging	Het
Jag1	T	A	2: 136,933,409 (GRCm39)	I506F	probably benign	Het
Nckap1	C	T	2: 80,348,286 (GRCm39)	S889N	probably benign	Het
Or52e8b	T	C	7: 104,673,285 (GRCm39)	T301A	probably damaging	Het
Or8k20	T	C	2: 86,106,612 (GRCm39)	N73S	probably damaging	Het
Plekhg6	C	G	6: 125,349,455 (GRCm39)	E381Q	probably damaging	Het
Prag1	A	G	8: 36,614,413 (GRCm39)	I1322V	possibly damaging	Het
Rasgrp3	A	G	17: 75,810,185 (GRCm39)	D295G	probably benign	Het
Sh3tc2	T	C	18: 62,101,171 (GRCm39)	V88A	probably benign	Het
Snrnp40	C	G	4: 130,271,836 (GRCm39)		probably null	Het
Vmn1r232	C	A	17: 21,133,705 (GRCm39)	L298F	possibly damaging	Het
Zfp629	C	A	7: 127,209,274 (GRCm39)	C845F	probably damaging	Het

Other mutations in Psmc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
E0370:Psmc3	UTSW	2	90,885,463 (GRCm39)	splice site	probably null
R0747:Psmc3	UTSW	2	90,884,645 (GRCm39)	missense	probably benign	0.10
R1763:Psmc3	UTSW	2	90,886,340 (GRCm39)	missense	possibly damaging	0.81
R1967:Psmc3	UTSW	2	90,888,189 (GRCm39)	missense	probably benign	0.19
R2056:Psmc3	UTSW	2	90,888,433 (GRCm39)	missense	probably benign	0.40
R2484:Psmc3	UTSW	2	90,886,346 (GRCm39)	missense	probably damaging	0.97
R3411:Psmc3	UTSW	2	90,886,263 (GRCm39)	missense	probably damaging	1.00
R3608:Psmc3	UTSW	2	90,884,925 (GRCm39)	missense	probably benign	0.00
R4917:Psmc3	UTSW	2	90,896,317 (GRCm39)	unclassified	probably benign
R4954:Psmc3	UTSW	2	90,885,974 (GRCm39)	intron	probably benign
R5033:Psmc3	UTSW	2	90,884,953 (GRCm39)	missense	probably benign	0.03
R5073:Psmc3	UTSW	2	90,884,915 (GRCm39)	splice site	probably benign
R5279:Psmc3	UTSW	2	90,884,667 (GRCm39)	missense	probably benign
R5354:Psmc3	UTSW	2	90,889,698 (GRCm39)	missense	probably damaging	1.00
R6169:Psmc3	UTSW	2	90,888,184 (GRCm39)	missense	probably damaging	1.00
R6224:Psmc3	UTSW	2	90,884,975 (GRCm39)	missense	probably damaging	1.00
R7039:Psmc3	UTSW	2	90,885,391 (GRCm39)	missense	probably benign	0.32
R7275:Psmc3	UTSW	2	90,886,275 (GRCm39)	missense	probably damaging	0.97
R7962:Psmc3	UTSW	2	90,887,007 (GRCm39)	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- AGACCTGGTGGTGAGTGATACCTG -3'
(R):5'- GCTCTGGCCCTTTATGTGGACAATC -3'

Sequencing Primer
(F):5'- AGGGATTCTCCAGTAAGCTGC -3'
(R):5'- GGACAATCTCCAATCTCTCTGGAATC -3'

Posted On

2014-01-15