Incidental Mutation 'R1182:Rasgrp3'
ID 101664
Institutional Source Beutler Lab
Gene Symbol Rasgrp3
Ensembl Gene ENSMUSG00000071042
Gene Name RAS, guanyl releasing protein 3
Synonyms LOC240168
MMRRC Submission 039254-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1182 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 75742891-75836049 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 75810185 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 295 (D295G)
Ref Sequence ENSEMBL: ENSMUSP00000129393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095204] [ENSMUST00000164192]
AlphaFold Q6NZH9
Predicted Effect probably benign
Transcript: ENSMUST00000095204
AA Change: D295G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000092828
Gene: ENSMUSG00000071042
AA Change: D295G

DomainStartEndE-ValueType
RasGEFN 2 125 6.77e-12 SMART
RasGEF 148 384 4.57e-104 SMART
EFh 424 452 1.07e-1 SMART
EFh 453 481 4.04e0 SMART
C1 495 544 5.47e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164192
AA Change: D295G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000129393
Gene: ENSMUSG00000071042
AA Change: D295G

DomainStartEndE-ValueType
RasGEFN 2 125 6.77e-12 SMART
RasGEF 148 384 4.57e-104 SMART
EFh 424 452 1.07e-1 SMART
EFh 453 481 4.04e0 SMART
C1 495 544 5.47e-17 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the RAS (see HRAS; MIM 190020) subfamily of GTPases function in signal transduction as GTP/GDP-regulated switches that cycle between inactive GDP- and active GTP-bound states. Guanine nucleotide exchange factors (GEFs), such as RASGRP3, serve as RAS activators by promoting acquisition of GTP to maintain the active GTP-bound state and are the key link between cell surface receptors and RAS activation (Rebhun et al., 2000 [PubMed 10934204]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant mice are viable and fertile with no obvious abnormalities in the kidneys or vasculature. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl1 T A 8: 84,656,451 (GRCm39) D256E probably damaging Het
Adnp G A 2: 168,026,716 (GRCm39) A193V possibly damaging Het
Atf7ip2 T C 16: 10,059,699 (GRCm39) L413S possibly damaging Het
Clip1 T C 5: 123,785,928 (GRCm39) N252S probably damaging Het
Cubn A T 2: 13,449,811 (GRCm39) N904K probably damaging Het
Draxin T C 4: 148,192,394 (GRCm39) E306G probably damaging Het
Gabrr1 T A 4: 33,132,680 (GRCm39) F9L probably benign Het
Hyal6 T A 6: 24,743,416 (GRCm39) C371S probably damaging Het
Jag1 T A 2: 136,933,409 (GRCm39) I506F probably benign Het
Nckap1 C T 2: 80,348,286 (GRCm39) S889N probably benign Het
Or52e8b T C 7: 104,673,285 (GRCm39) T301A probably damaging Het
Or8k20 T C 2: 86,106,612 (GRCm39) N73S probably damaging Het
Plekhg6 C G 6: 125,349,455 (GRCm39) E381Q probably damaging Het
Prag1 A G 8: 36,614,413 (GRCm39) I1322V possibly damaging Het
Psmc3 T C 2: 90,886,380 (GRCm39) I179T probably damaging Het
Sh3tc2 T C 18: 62,101,171 (GRCm39) V88A probably benign Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Vmn1r232 C A 17: 21,133,705 (GRCm39) L298F possibly damaging Het
Zfp629 C A 7: 127,209,274 (GRCm39) C845F probably damaging Het
Other mutations in Rasgrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02270:Rasgrp3 APN 17 75,823,368 (GRCm39) missense probably benign 0.00
IGL02529:Rasgrp3 APN 17 75,832,097 (GRCm39) missense possibly damaging 0.84
IGL02672:Rasgrp3 APN 17 75,803,412 (GRCm39) missense probably benign 0.00
IGL02935:Rasgrp3 APN 17 75,804,065 (GRCm39) missense probably benign 0.00
Aster UTSW 17 75,816,822 (GRCm39) splice site probably null
aston UTSW 17 75,807,753 (GRCm39) critical splice donor site probably null
centre UTSW 17 75,807,729 (GRCm39) missense possibly damaging 0.50
P0021:Rasgrp3 UTSW 17 75,807,708 (GRCm39) missense probably damaging 1.00
PIT4243001:Rasgrp3 UTSW 17 75,807,134 (GRCm39) missense probably damaging 1.00
R0090:Rasgrp3 UTSW 17 75,805,456 (GRCm39) missense probably damaging 1.00
R0907:Rasgrp3 UTSW 17 75,816,822 (GRCm39) splice site probably null
R1412:Rasgrp3 UTSW 17 75,816,822 (GRCm39) splice site probably null
R1572:Rasgrp3 UTSW 17 75,807,729 (GRCm39) missense possibly damaging 0.50
R1664:Rasgrp3 UTSW 17 75,831,172 (GRCm39) missense probably damaging 1.00
R2094:Rasgrp3 UTSW 17 75,810,136 (GRCm39) missense probably damaging 1.00
R2111:Rasgrp3 UTSW 17 75,807,753 (GRCm39) critical splice donor site probably null
R3026:Rasgrp3 UTSW 17 75,831,916 (GRCm39) missense possibly damaging 0.52
R4052:Rasgrp3 UTSW 17 75,803,963 (GRCm39) missense probably damaging 1.00
R4348:Rasgrp3 UTSW 17 75,818,975 (GRCm39) missense probably benign 0.00
R4509:Rasgrp3 UTSW 17 75,807,668 (GRCm39) missense probably damaging 1.00
R4642:Rasgrp3 UTSW 17 75,805,443 (GRCm39) missense possibly damaging 0.64
R4791:Rasgrp3 UTSW 17 75,807,168 (GRCm39) missense probably benign 0.37
R4901:Rasgrp3 UTSW 17 75,821,111 (GRCm39) nonsense probably null
R4927:Rasgrp3 UTSW 17 75,823,350 (GRCm39) missense probably benign 0.00
R5410:Rasgrp3 UTSW 17 75,804,042 (GRCm39) missense probably benign 0.01
R5444:Rasgrp3 UTSW 17 75,810,370 (GRCm39) missense probably damaging 0.99
R5483:Rasgrp3 UTSW 17 75,832,013 (GRCm39) missense probably damaging 1.00
R5518:Rasgrp3 UTSW 17 75,823,354 (GRCm39) missense probably benign 0.36
R5755:Rasgrp3 UTSW 17 75,831,940 (GRCm39) missense probably benign 0.44
R5845:Rasgrp3 UTSW 17 75,810,142 (GRCm39) missense possibly damaging 0.61
R6310:Rasgrp3 UTSW 17 75,801,204 (GRCm39) missense probably damaging 1.00
R6604:Rasgrp3 UTSW 17 75,810,110 (GRCm39) missense probably benign 0.10
R6826:Rasgrp3 UTSW 17 75,810,241 (GRCm39) missense probably damaging 1.00
R7409:Rasgrp3 UTSW 17 75,823,411 (GRCm39) missense possibly damaging 0.48
R7507:Rasgrp3 UTSW 17 75,804,055 (GRCm39) missense probably damaging 1.00
R7536:Rasgrp3 UTSW 17 75,821,128 (GRCm39) missense probably damaging 1.00
R7538:Rasgrp3 UTSW 17 75,803,411 (GRCm39) missense probably benign
R8089:Rasgrp3 UTSW 17 75,804,056 (GRCm39) missense possibly damaging 0.54
R8677:Rasgrp3 UTSW 17 75,819,055 (GRCm39) missense probably benign 0.00
R9483:Rasgrp3 UTSW 17 75,807,717 (GRCm39) missense probably benign 0.22
R9521:Rasgrp3 UTSW 17 75,821,158 (GRCm39) missense probably null 1.00
R9557:Rasgrp3 UTSW 17 75,807,139 (GRCm39) missense probably damaging 0.98
R9727:Rasgrp3 UTSW 17 75,810,239 (GRCm39) missense probably damaging 1.00
R9757:Rasgrp3 UTSW 17 75,807,719 (GRCm39) missense probably damaging 1.00
X0011:Rasgrp3 UTSW 17 75,832,161 (GRCm39) nonsense probably null
Z1177:Rasgrp3 UTSW 17 75,819,090 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCCATTTAGCAGCTCATAGGTGCG -3'
(R):5'- GGTTCCAAGTGGTGAGAGGCATTC -3'

Sequencing Primer
(F):5'- TCCTGCATCAACATTGGTACAG -3'
(R):5'- GCTGGTGCATTTTCACAACG -3'
Posted On 2014-01-15