Incidental Mutation 'R1184:Soat1'
ID101849
Institutional Source Beutler Lab
Gene Symbol Soat1
Ensembl Gene ENSMUSG00000026600
Gene Namesterol O-acyltransferase 1
SynonymsACAT-1, 8430426K15Rik, Acact, hid
MMRRC Submission 039256-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R1184 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location156424525-156474331 bp(-) (GRCm38)
Type of Mutationsplice site (7 bp from exon)
DNA Base Change (assembly) G to A at 156442374 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051396] [ENSMUST00000187507] [ENSMUST00000188027] [ENSMUST00000189661]
Predicted Effect probably null
Transcript: ENSMUST00000051396
SMART Domains Protein: ENSMUSP00000058344
Gene: ENSMUSG00000026600

DomainStartEndE-ValueType
low complexity region 39 52 N/A INTRINSIC
transmembrane domain 130 152 N/A INTRINSIC
Pfam:MBOAT 161 510 3.9e-71 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187073
Predicted Effect probably null
Transcript: ENSMUST00000187507
SMART Domains Protein: ENSMUSP00000139431
Gene: ENSMUSG00000026600

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
transmembrane domain 97 119 N/A INTRINSIC
transmembrane domain 141 160 N/A INTRINSIC
transmembrane domain 181 203 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000188027
Predicted Effect probably null
Transcript: ENSMUST00000189661
SMART Domains Protein: ENSMUSP00000140721
Gene: ENSMUSG00000026600

DomainStartEndE-ValueType
low complexity region 39 52 N/A INTRINSIC
transmembrane domain 130 152 N/A INTRINSIC
Pfam:MBOAT 161 510 1.2e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191379
Meta Mutation Damage Score 0.6072 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the acyltransferase family. It is located in the endoplasmic reticulum, and catalyzes the formation of fatty acid-cholesterol esters. This gene has been implicated in the formation of beta-amyloid and atherosclerotic plaques by controlling the equilibrium between free cholesterol and cytoplasmic cholesteryl esters. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mutants producing no protein or a truncated protein show depletion of cholesterol esters in adrenal cortex and peritoneal macrophages. Additionally, null mutants have reduced eye openings due to atrophy of meibomian glands or abnromal morphology and arrangement of medullary cells of all hair types. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,160,912 R7G probably damaging Het
2410089E03Rik G T 15: 8,216,487 V1448L probably benign Het
Ahdc1 T A 4: 133,065,396 M1316K probably benign Het
Alkal1 A G 1: 6,389,488 Y96C probably damaging Het
Arhgap17 T C 7: 123,314,690 Y199C probably damaging Het
Bmp2 T C 2: 133,561,468 V313A probably damaging Het
Cacna1b C T 2: 24,687,745 probably null Het
Cars T C 7: 143,587,139 T141A probably damaging Het
Ccdc57 A G 11: 120,873,811 probably benign Het
Cenpe T C 3: 135,264,422 probably null Het
Chadl T C 15: 81,693,057 S198G probably benign Het
Chd6 G C 2: 161,030,802 P286R probably damaging Het
Clec4a4 G T 6: 123,012,712 W104L probably benign Het
Coq4 G A 2: 29,788,334 probably benign Het
Crtc2 T A 3: 90,262,633 Y445* probably null Het
Dapk1 A T 13: 60,696,298 I44F probably damaging Het
Dcbld2 T A 16: 58,449,841 probably null Het
Dcun1d4 T C 5: 73,511,112 probably benign Het
Depdc7 A T 2: 104,730,178 probably benign Het
Dna2 A G 10: 62,959,198 D416G probably benign Het
Dnah2 A T 11: 69,499,190 I743N probably damaging Het
Dnah9 A G 11: 66,084,612 probably null Het
Dock3 A G 9: 106,969,800 S877P probably damaging Het
Eif3l T A 15: 79,075,766 probably null Het
Epha5 A T 5: 84,071,275 probably null Het
Ffar3 T A 7: 30,855,104 N264Y probably damaging Het
Fyb A T 15: 6,638,900 I525F probably damaging Het
Fyco1 A G 9: 123,819,153 F1239L probably damaging Het
Gcdh T C 8: 84,893,442 probably benign Het
Gk5 T C 9: 96,150,420 probably benign Het
Gm21188 A T 13: 120,035,131 N67K probably benign Het
Gm8979 A G 7: 106,083,952 V32A probably benign Het
Grm1 A G 10: 10,720,034 Y617H probably benign Het
Hhipl2 A T 1: 183,425,134 I131L probably damaging Het
Larp4b T C 13: 9,166,309 probably benign Het
Lrig2 T A 3: 104,490,911 I301F possibly damaging Het
Man2a2 A T 7: 80,362,965 I600N possibly damaging Het
Mylk2 G C 2: 152,913,741 probably null Het
Myo6 C T 9: 80,286,382 Q870* probably null Het
Napg T G 18: 62,994,338 H204Q probably benign Het
Neb G A 2: 52,263,947 T2384M probably damaging Het
Nek10 A G 14: 14,931,325 probably benign Het
Olfr1216 A G 2: 89,013,713 M117T probably damaging Het
Olfr1440 T C 19: 12,394,857 V198A probably benign Het
Olfr1462 T G 19: 13,191,375 L236R probably damaging Het
Olfr748 A C 14: 50,710,614 T95P probably benign Het
Pclo A G 5: 14,522,262 T554A unknown Het
Perm1 C A 4: 156,217,314 T105K probably damaging Het
Pik3r1 T C 13: 101,686,358 probably null Het
Pld5 A G 1: 176,044,896 I225T probably damaging Het
Plxnc1 T C 10: 94,831,333 probably benign Het
Ptpn12 A C 5: 20,998,356 S475A possibly damaging Het
Ptprt A G 2: 161,927,772 V391A possibly damaging Het
Rac2 T G 15: 78,565,945 D65A possibly damaging Het
Rgl3 A G 9: 21,977,380 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sebox A T 11: 78,503,849 T47S probably damaging Het
Sema4b A G 7: 80,224,640 T593A probably benign Het
Serpina3a C T 12: 104,116,528 Q187* probably null Het
Serpinb1a T C 13: 32,843,216 K248E probably benign Het
Serpinb9e A C 13: 33,259,774 E259A probably benign Het
Slc30a3 T A 5: 31,090,166 H44L probably damaging Het
Smarca2 T C 19: 26,770,933 probably benign Het
Snrnp200 T A 2: 127,236,817 C1801S probably damaging Het
Spink6 T C 18: 44,071,538 probably benign Het
Spta1 G A 1: 174,184,690 R354H probably damaging Het
Tbck T A 3: 132,837,972 H861Q probably benign Het
Tgfbrap1 G A 1: 43,049,696 T849M possibly damaging Het
Tnrc6a A G 7: 123,170,340 N451S possibly damaging Het
Trim36 T C 18: 46,196,251 T41A probably damaging Het
Trmt112 C A 19: 6,910,353 probably benign Het
Trpc4ap A G 2: 155,645,070 probably benign Het
Ttll7 C T 3: 146,939,991 P535S probably damaging Het
Ttn A T 2: 76,861,432 probably benign Het
Txndc11 C T 16: 11,128,500 R149Q probably benign Het
Ubr4 C T 4: 139,437,198 probably benign Het
Usp30 G A 5: 114,103,827 probably null Het
Vmn1r195 A G 13: 22,279,011 Y217C probably damaging Het
Vps33b T A 7: 80,282,486 D135E probably benign Het
Vrk2 A G 11: 26,483,331 probably benign Het
Wdr81 G T 11: 75,452,983 P486Q probably damaging Het
Zfp788 T C 7: 41,648,326 Y129H probably damaging Het
Other mutations in Soat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00537:Soat1 APN 1 156466730 missense probably benign 0.37
IGL00840:Soat1 APN 1 156434196 missense probably damaging 1.00
IGL00980:Soat1 APN 1 156441341 missense probably benign 0.00
IGL02032:Soat1 APN 1 156440575 missense probably benign 0.00
IGL02177:Soat1 APN 1 156440503 splice site probably benign
IGL02718:Soat1 APN 1 156441429 missense probably benign 0.02
IGL02756:Soat1 APN 1 156446575 missense probably benign
IGL02884:Soat1 APN 1 156441356 missense possibly damaging 0.88
R0309:Soat1 UTSW 1 156442453 missense probably damaging 1.00
R0315:Soat1 UTSW 1 156440513 nonsense probably null
R0492:Soat1 UTSW 1 156441354 missense probably benign 0.00
R0519:Soat1 UTSW 1 156441246 missense probably damaging 1.00
R1187:Soat1 UTSW 1 156434175 missense probably damaging 1.00
R1310:Soat1 UTSW 1 156441332 missense possibly damaging 0.92
R1378:Soat1 UTSW 1 156466782 utr 5 prime probably benign
R1547:Soat1 UTSW 1 156439761 missense probably damaging 0.98
R1690:Soat1 UTSW 1 156444574 missense probably benign
R1771:Soat1 UTSW 1 156442421 missense probably benign
R1776:Soat1 UTSW 1 156442421 missense probably benign
R2264:Soat1 UTSW 1 156437697 splice site probably benign
R2483:Soat1 UTSW 1 156431099 missense probably damaging 1.00
R4838:Soat1 UTSW 1 156432937 missense probably benign 0.05
R4863:Soat1 UTSW 1 156432328 missense probably damaging 0.98
R5366:Soat1 UTSW 1 156444611 missense probably benign 0.00
R5828:Soat1 UTSW 1 156437748 missense probably benign 0.01
R6381:Soat1 UTSW 1 156435803 missense probably damaging 0.99
R6583:Soat1 UTSW 1 156466492 intron probably null
R7085:Soat1 UTSW 1 156432331 missense not run
Predicted Primers PCR Primer
(F):5'- ACAAAAGTGGCCTTCTGTAGCCC -3'
(R):5'- GATTACTAACCCCTGACCCGCTTG -3'

Sequencing Primer
(F):5'- AGATCACCGTCAGCTATGTG -3'
(R):5'- TGACCCGCTTGGCCTAC -3'
Posted On2014-01-15